Fumarylacetoacetate hydrolase (FAH)-deficient and immunodeficient rats and uses thereof

Inactive Publication Date: 2014-12-18
YECURIS CORP
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent is about a method of creating rats with humanized livers by transplanting heterologous hepatocytes into rats. The hepatocytes can be isolated from humans or other sources like mice or pigs. The rats can also be genetically modified or have liver injury induced to facilitate the engraftment and expansion of the hepatocytes. The method involves injecting the hepatocytes into the rat and allowing them to expand and function. The rats can also be immunosuppressed to prevent rejection of the hepatocytes. The technical effect of this patent is the creation of a new model for studying liver injury and regeneration using human hepatocytes in rats.

Problems solved by technology

The availability of high quality human hepatocytes is further hampered by the fact that they cannot be significantly expanded in tissue culture.
Hepatocytes from readily available mammalian species, such as the mouse, are not suitable for drug testing because they have a different complement of metabolic enzymes and respond differently in induction studies.
Immortal human liver cells (hepatomas) or fetal hepatoblasts are also not an adequate replacement for fully differentiated adult cells.
Currently, human hepatocytes cannot be expanded significantly in culture.
Hepatocytes derived from stem cells in culture are immature and generally lack full functionality.
Therefore, all hepatocytes in use today are derived from human donors, either cadaveric or surgical specimens, which significantly limits hepatocyte availability.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fumarylacetoacetate hydrolase (FAH)-deficient and immunodeficient rats and uses thereof
  • Fumarylacetoacetate hydrolase (FAH)-deficient and immunodeficient rats and uses thereof
  • Fumarylacetoacetate hydrolase (FAH)-deficient and immunodeficient rats and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Generation of the AAV-rFAH:PGK-NEO Null Targeting Vector and Production of FAH KO Rat ES Cells

[0177]The rat FAH KO construct targets exon 3 of the FAH gene. Rat ES cell genomic DNA was used to generate 5′ and 3′ FAH homology regions for the targeting construct. A 5′ FAH homology region was generated using a forward primer 1.5 kb upstream of exon 3 (intron 1-2; Table 1), and the reverse primer containing a stop codon ending 54 bp into exon 3 of the FAH gene (SEQ ID NO:1; FIG. 1). A 3′ FAH homology region was generated using a forward primer starting 90 bp into exon3 and ending in intron 4-5 (1.5 kb; Table 1). The two 1.5 kb PCR products were cloned, sequenced and ligated to a PGK:NEO selection cassette totaling 4.7 kb (FIG. 2). The nucleotide sequence of the targeting cassette is set forth herein as SEQ ID NO:2.

[0178]The 4.7 kb fragment was ligated into the pcDNA 3.1 vector, which was linearized and transfected into rat 208D fibroblast cells to examine NEO resistance. The cells were ...

example 2

Generation of FAH KO Rats and Transplantation of Human Hepatocytes

[0182]FAH KO rats were generated by injecting FAH KO ES cells into rat blastocysts, which are then transferred to E3.5 pseudo-pregnant SD rats. The chimeric progeny from these rats are bred to generate heterozygous FAH KO rats by germline transmission. Male and female heterozygotes are then further bred to generate FAH knockout rats. The deletion of the FAH gene allows for the induction of liver damage to aid in high levels of engraftment and repopulation of the liver with transplanted human hepatocytes.

[0183]Prior to transplantation with human hepatocytes, acute liver damage is induced in the rats by dosing with a recombinant adenovirus expressing the plasminogen-like urokinase enzyme. Twenty-four hours later the human hepatocytes are delivered via intra-splenic injection where the hepatocytes will travel through the vasculature to reach the liver. In addition, immune suppression drugs are given to the rats before, d...

example 3

Generation of the Il2rg Construct

[0184]The rat Il2rg construct targets exon 3 of the Il2rg gene. Rat ES cell genomic DNA was used to generate 5′ and 3′ Il2rg homology regions for the targeting construct. A 5′ Il2rg homology region was generated using a forward primer 1.46 kb upstream of exon 3 (Table 2), and a reverse primer containing a stop codon ending 40 bp inside exon 3 of the IL2rg gene. A 3′ Il2rg homology region was generated using a forward primer containing 40 bp of exon3 and ending in exon 6 (1.5 kb; Table 2). The two 1.5 kb PCR products were cloned, sequenced and ligated to a PGK:NEO selection cassette totaling 4.7 kb, similar to that of the FAH construct described in Example 1. The construct was sequenced and used for viral production.

TABLE 2Primers used in the design of the rIL2rg constructPrimer Sequence SEQPrimer Location5′ to 3′ID NO:5′ Rat IL2rg FORgtagcgaattcgcggccgctg17attggattctcggtgtga5′ Rat IL2rg REVggatagaattcgtcagtggct18gcactcctggaatgtattatt3′ Rat IL2rg FORg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Timeaaaaaaaaaa
Login to View More

Abstract

Described herein are rats with a hepatic deficiency comprising decreased function, activity, or expression of an enzyme in the tyrosine catabolic pathway (such as fumarylacetoacetate hydrolase), and methods of using the same for in vivo engraftment and expansion of heterologous hepatocytes, such as human hepatocytes, analysis of human liver disease, and analysis of xenobiotics. Also disclosed is the use of immunodeficient rats for the engraftment and expansion of heterologous hepatocytes.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]The present application claims the priority benefit of U.S. Provisional Patent Application Ser. No. 61 / 527,865, filed Aug. 26, 2011, FUMARYLACETOACETATE HYDROLASE (FAH)-DEFICIENT ANIMALS AND USE THEREOF, incorporated by reference in its entirety herein.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT[0002]This invention was made in part with government support under grant number 1DP2OD008396-01, awarded by the National Institutes of Health. The U.S. government has certain rights in the invention.SEQUENCE LISTING[0003]The nucleic and amino acid sequences listed in the accompanying sequence are presented in accordance with 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on Aug. 24, 2012, 22 KB, which is incorporated by reference herein. In th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/027
CPCA01K67/0278A01K2267/03A01K2227/105C07K14/7155C12Y307/01002C12N9/14A01K2207/12A01K2207/15A01K2217/00A01K2217/075A01K2267/0387C12N2750/14143C12Y304/21073C12N9/6462A01K67/0276
InventorBIAL, JOHN R.WILSON, ELIZABETH M.GEURTS, ARON M.
OwnerYECURIS CORP