Expression carrier for RNA interference research
A technology of eukaryotic expression vector and vector, applied in the field of genetic engineering, can solve the problems of low efficiency, shortened experimental period, long experimental period and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Construction of PSec-pol plasmid
[0034] According to the known mouse U6 RNA polymerase III (PolIII) promoter sequence, design synthetic PCR primers: upstream primers:
[0035] 5'-CAATGGGAGTTTGTTTTGTCTAGAACTAGTCGATCCGACGCCGCCATCTCTAG-3';
[0036] Downstream primers:
[0037] 5'-GGGGATCCAAACAAGGCTTTTCTCCAAGG-3'(BamH I), using mouse genomic DNA as a template, amplified to obtain a PolIII fragment (354bp), the nucleotide sequence of which is shown in SEQ ID NO:3.
[0038] According to the CMV enhancer sequence (CMV enhancer) of the pSec-Tag2A vector, design and synthesize PCR primers: upstream primer: 5'-GCCAGATATACGCGTT-3' (Mlu I),
[0039] Downstream primer: 5′-CGTCGGATCGACTAGTTCTAGACAAAACAAACTCCCATTG-3′; the CMV enhancer fragment (519bp) was amplified using the pSec-Tag2A vector as a template, and its nucleotide sequence is shown in SEQ ID NO:4.
[0040] Since the downstream primer of CMV enhancer and the upstream primer of PolIII are completely complement...
Embodiment 2
[0042] Example 2 Construction of pAdTrack-pol plasmid
[0043] Restriction endonuclease analysis showed that there was a single restriction endonuclease Nde I site at the upstream and downstream of the pAdTrack-CMV vector multiple cloning site. The Nde I (CATATG) site downstream of the pAdTrack-CMV multiple cloning site was mutated into CATATC by PCR mutagenesis, and only the single Nde I site upstream of the multiple cloning site was retained. At the same time, the CMV enhancer-MLC-2V fragment was prepared by the PCR amplification ligation method, and the CMV enhancer-MLC-2V fragment was replaced by the CMV enhancer and promoter of the original pAdTrack-CMV plasmid by the directional cloning method.
[0044] The specific method is as follows: according to the single HindIII and NheI sites on both sides of the downstream Nde I site of the pAdTrack-CMV vector multi-cloning site, two pairs of primers were designed to amplify the corresponding fragments respectively. The first p...
Embodiment 3
[0056] Example 3 Cytology experiment:
[0057] Using Lipofectamine2000 reagent, 3ug of pN3-EGFP plasmid DNA was transformed into human embryonic umbilical vein endothelial cells (HUVECs) with an abundance of 80%. Pressurize with 800ug / mL G418, and observe that all cells express green fluorescent protein (GFP), pressurize with 400ug / mL G418, and continue to scale up the culture.
[0058] According to the reported 22-nt siRNA sequence that can inhibit the expression of GFP, the DNA template of the siRNA targeting the GFP gene fragment GCGATGCCACCTACGGCAAGC was prepared, and the siRNA expression vector pSec-pol-GFP was constructed. Using Lipofectamine2000 reagent, pSec-pol and pSec-pol-GFP were transfected into GFP-expressing HUVECs, and 48 hours after transfection, the expression level of GFP was detected by cell image analysis system and Real-time quantitative PCR, respectively. The detection results showed that, compared with the control group, the expression levels of GFP pr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More