Tomato RNA virus host factor and genes encoding same and use thereof
An RNA virus, encoding gene technology, applied in the biological field, can solve the problem of the virus not being able to replicate or the efficiency of replication is reduced, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Embodiment 1, the cloning of the full-length cDNA sequence of tomato host factor gene ToTOM3
[0065] 1. Cloning of ToTOM3 3' end cDNA
[0066] According to the tomato EST sequence BI923910 (250nt) (gi: 16225384) found in GenBank that has a certain homology with Arabidopsis ATOM3 (gi: 15425640), two forward primers were designed to amplify the cDNA sequence at the 3' end of ToTOM3. The primer sequences are as follows :
[0067] ttom3-1: 5'-CGGAGATGGTTGTAGGCCCG-3';
[0068] ttom3-A: 5'-TGAATGATGCAATCAATTGG-3'
[0069] The cDNA at the 3' end of ToTOM was synthesized using the 3'RACE System for Rapid Aplication of cDNA Ends kit (Invitrogen, catalog number 18373-027). The total RNA of tomato was extracted, and its first-strand cDNA was synthesized by reverse transcription. The reaction system and reaction conditions were: 8 μL ddH 2 O(RNase-Free), 1 μL AP (10 μM) (AP: 5’-GCCACGCGTCGACTAGTACT(T) 16 -3'), 3 μL tomato total RNA (about 5 μg) and 1 μL dNTP (10 mM), after mi...
Embodiment 2
[0077] Cloning of embodiment 2, ToTOM3 genome gene
[0078] According to the obtained full-length cDNA sequence of ToTOM3, primers were designed to amplify the genome sequence of ToTOM3. The primer sequences are as follows:
[0079] ttom3-1: 5'-CGGAGATGGTTGTAGGCCCG-3';
[0080] ttom3-2: 5'-CCATTCACAAAGAAATTGAG-3'
[0081] With tomato total DNA as template, under the guidance of primer ttom3-1 and primer ttom3-2, carry out PCR amplification, carry out 0.8% agarose gel electrophoresis detection to PCR after reaction finishes, and detection result is as shown in Figure 5 (swimming lane M: 1KbDNAMarker, lane 1: PCR-amplified gene fragment of ToTOM3), indicating that a gene fragment of ToTOM3 with a size of about 2.3kb was amplified, and the DNA fragment was sequenced, and the sequencing results showed that the fragment contained a partial sequence of ToTOM3. The total tomato DNA was digested with the restriction endonuclease EcoR V, and the digested product was electrophoresed o...
Embodiment 3
[0082] Embodiment 3, the acquisition of transgenic tomato plants
[0083] 1. Construction of plant expression vectors
[0084] 1. Construction of plant expression vectors containing ToTOM3 antisense RNA
[0085] Primers were designed according to the 5' and 3' UTR sequences of the full-length cDNA of tomato ToTOM3, and the primer sequences were as follows:
[0086] ttom3-F: GTGAGTTTGATTTTGGAATCTCCG;
[0087] ttom3-G2: GAGAACAACGTGAAGTTTCAGGAG
[0088]Using the total tomato DNA as a template, under the guidance of primers ttom3-F and ttom3-G2, PCR amplifies the full-length genome gene fragment of ToTOM3. After the reaction, the PCR was tested by 0.8% agarose gel electrophoresis. The test results are shown in the figure As shown in 10 (lane M: 1Kb DNA Marker, lane 1: PCR product), it shows that a specific band of about 6.5kb was amplified. Reclaim this specific PCR product, connect it with carrier pCR2.1-TOPO (Invitrogen Company), obtain 3 kinds of recombinant plasmids bigge...
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
