Unlock instant, AI-driven research and patent intelligence for your innovation.

Tomato RNA virus host factor and genes encoding same and use thereof

An RNA virus, encoding gene technology, applied in the biological field, can solve the problem of the virus not being able to replicate or the efficiency of replication is reduced, etc.

Inactive Publication Date: 2008-02-13
GUANGXI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If these host factors are lacking in the host cell, the virus cannot replicate or the efficiency of replication is greatly reduced (Ahlquist P., Noueiry, A.O., and Lee, W.M., et al., 2003.Host Factor in Positive-Strand RNA Viruses Genome Replication.Journal of Virology, 77(15): 8181-8126.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tomato RNA virus host factor and genes encoding same and use thereof
  • Tomato RNA virus host factor and genes encoding same and use thereof
  • Tomato RNA virus host factor and genes encoding same and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Embodiment 1, the cloning of the full-length cDNA sequence of tomato host factor gene ToTOM3

[0065] 1. Cloning of ToTOM3 3' end cDNA

[0066] According to the tomato EST sequence BI923910 (250nt) (gi: 16225384) found in GenBank that has a certain homology with Arabidopsis ATOM3 (gi: 15425640), two forward primers were designed to amplify the cDNA sequence at the 3' end of ToTOM3. The primer sequences are as follows :

[0067] ttom3-1: 5'-CGGAGATGGTTGTAGGCCCG-3';

[0068] ttom3-A: 5'-TGAATGATGCAATCAATTGG-3'

[0069] The cDNA at the 3' end of ToTOM was synthesized using the 3'RACE System for Rapid Aplication of cDNA Ends kit (Invitrogen, catalog number 18373-027). The total RNA of tomato was extracted, and its first-strand cDNA was synthesized by reverse transcription. The reaction system and reaction conditions were: 8 μL ddH 2 O(RNase-Free), 1 μL AP (10 μM) (AP: 5’-GCCACGCGTCGACTAGTACT(T) 16 -3'), 3 μL tomato total RNA (about 5 μg) and 1 μL dNTP (10 mM), after mi...

Embodiment 2

[0077] Cloning of embodiment 2, ToTOM3 genome gene

[0078] According to the obtained full-length cDNA sequence of ToTOM3, primers were designed to amplify the genome sequence of ToTOM3. The primer sequences are as follows:

[0079] ttom3-1: 5'-CGGAGATGGTTGTAGGCCCG-3';

[0080] ttom3-2: 5'-CCATTCACAAAGAAATTGAG-3'

[0081] With tomato total DNA as template, under the guidance of primer ttom3-1 and primer ttom3-2, carry out PCR amplification, carry out 0.8% agarose gel electrophoresis detection to PCR after reaction finishes, and detection result is as shown in Figure 5 (swimming lane M: 1KbDNAMarker, lane 1: PCR-amplified gene fragment of ToTOM3), indicating that a gene fragment of ToTOM3 with a size of about 2.3kb was amplified, and the DNA fragment was sequenced, and the sequencing results showed that the fragment contained a partial sequence of ToTOM3. The total tomato DNA was digested with the restriction endonuclease EcoR V, and the digested product was electrophoresed o...

Embodiment 3

[0082] Embodiment 3, the acquisition of transgenic tomato plants

[0083] 1. Construction of plant expression vectors

[0084] 1. Construction of plant expression vectors containing ToTOM3 antisense RNA

[0085] Primers were designed according to the 5' and 3' UTR sequences of the full-length cDNA of tomato ToTOM3, and the primer sequences were as follows:

[0086] ttom3-F: GTGAGTTTGATTTTGGAATCTCCG;

[0087] ttom3-G2: GAGAACAACGTGAAGTTTCAGGAG

[0088]Using the total tomato DNA as a template, under the guidance of primers ttom3-F and ttom3-G2, PCR amplifies the full-length genome gene fragment of ToTOM3. After the reaction, the PCR was tested by 0.8% agarose gel electrophoresis. The test results are shown in the figure As shown in 10 (lane M: 1Kb DNA Marker, lane 1: PCR product), it shows that a specific band of about 6.5kb was amplified. Reclaim this specific PCR product, connect it with carrier pCR2.1-TOPO (Invitrogen Company), obtain 3 kinds of recombinant plasmids bigge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

The present invention discloses one kind of tomato RNA virus host factor and its coding gene and application in antiviral breeding of plant. The tomato RNA virus host factor is protein possessing one of the following amino acid residue sequences: 1) SEQ ID No. 1 in the sequence list; and 2) the amino acid residue sequence of SEQ ID No. 1 in the sequence list and through the substitution, deletion or addition of 1-10 amino acid residues and supporting virus copying protein. Silencing the protein coding gene inside plant body via transgenic antisense gene segment or RNA interfering can obtain antiviral plant. The tomato RNA virus host factor gene ToTOM3 and the method of inhibiting the expression of the gene has practical significance and wide application foreground in culturing and breeding antiviral plant.

Description

technical field [0001] The invention relates to a protein and its coding gene and application in the field of biotechnology, in particular to a tomato RNA virus host factor and its coding gene and its application in plant anti-virus breeding. Background technique [0002] Tomato is an important fruit-type vegetable. During its growth and development, it is vulnerable to various diseases, among which viral diseases are the most serious. Most of the viruses infecting tomato reported so far are RNA viruses, of which seven are the most common, namely cucumber mosaic virus (CMV), tobacco mosaic virus (Tabacco mosaic virus, TMV), tomato Mosaic virus (Tomato mosaic virus, ToMV), potato virus Y (PVY), tomato bushy stunt virus (TBSV), tomato infertility virus (Tomato aspermy virus, TAV) and tomato mosaic virus Green spot virus (Tomatochlorotic spot virus, TCSV). [0003] Plant virus disease is one of the important diseases that cause great loss of agricultural production. Since v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N1/20A01H1/00
Inventor 陈保善蒙姣荣
Owner GUANGXI UNIV