Biological molecule high flux quantitative detection method
A quantitative detection method and technology of biomolecules, applied in the field of high-throughput quantitative detection of biomolecules, can solve the problems of difficult application development, inability to provide quantitative formulas, and high application prices.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Example 1 Biomolecular Coding Analysis (BMCA) Method for Analyzing Nucleic Acid Fragments
[0080] Use 124bpds DNA as rBRE-CM, and E. coli 16S RNA genome probe as tBRE 1 , with 175bp ds DNA as CM 1 , with Staphylococcus aureus 16S RNA genomic probe as tBRE 2 , CM labeled with 322bp ds DNA 2 , prepared by rBRE-CM 3.3ng / μl, tBRE-CM 1 3.9ng / μl, tBRE-CM 2 15ng / μl detection reagent. The PCR products of 16S RNA genomic DNA of Pseudomonas aeruginosa and Staphylococcus aureus were used as detection specimens. Using Agilent 2100 biochip analyzer and DNA2100 electrophoresis chip as separation and detection methods, a BMCA detection system was established to detect the PCR product of 16S RNA gene of Staphylococcus aureus.
[0081] TM: Staphylococcus aureus 16S RNA gene fragment
[0082] wxya 1 : 5′CGAACGGTAACAGGAAGAAGC 3′
[0083] wxya 2 : 5′ CTTCTCTGATGTTAGCGGCG 3′
[0084] CM 1 : 5′ CGTGGTCATCACCTCG TCAATTGGTGCGGTCTACATGGACCCGAACCGTGACCCTGAAGCCGTCGTTGACGAAAGTTGCTGGA...
Embodiment 2
[0118] Example 2 Biomolecular Coding Analysis (BMCA) Method for Analyzing Proteins
[0119] 124bp dsDNA as rBRE-CM, Digoxigenin (Dig) as tBRE 1 , with 367bpdsDNA as CM 1 , with biotin (Bio) as tBRE 2 , with 394 bp dsDNA as CM 2, according to 2.0ng / μl rBRE-CM, 1.6ng / μl Dig-367bpdsDNA (tBRE 1 -CM 1 ) and 2.0ng / μl Bio-394bpdsDNA (tBRE 2 -CM 2 ) to form BMCA detection reagent R1, using Agilent 2100 bioanalyzer and DNA 1000 electrophoresis chip as separation and detection methods to construct a BMCA detection system.
[0120] TM: streptavidin
[0121] The following describes in detail the process of using the biomolecular coding analysis method (BMCA) to carry out the protein detection process in this embodiment:
[0122] 1. Preparation of detection reagents
[0123] (1) PCR preparation of 124bp dsDNA:
[0124] PCR primer S: 5′GACGATCCCGAGCAAAT 3′
[0125] PCR Primer A: 5′GTCCATGTAGACCGCACC 3′
[0126] PCR template: a fragment of a cinnamoyl-CoA reductase (CCR) gene in ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 