Unlock instant, AI-driven research and patent intelligence for your innovation.

Biological molecule high flux quantitative detection method

A quantitative detection method and technology of biomolecules, applied in the field of high-throughput quantitative detection of biomolecules, can solve the problems of limited detection throughput, no quantitative analysis, errors, etc.

Active Publication Date: 2011-05-18
GUANGZHOU BDS BIOLOGICAL TECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although xMAP technology has some significant advantages over Biochips technology, such as almost no steric hindrance effect, fast hybridization reaction and high efficiency; the repeatability is greatly improved, xMAP can greatly improve the detection of multiple microspheres of the same color by repeated detection However, xMAP technology also has some significant deficiencies: (1) The detection throughput is limited. Due to the fluorescent coding, a maximum of 100 polypropylene microspheres of different colors can be obtained. xMAP’s The detection throughput cannot exceed 100 kinds of TM / test; (2) Application development is difficult and costly. For each type of TM detected by xMAP, two different BREs need to be developed, which increases the difficulty, cycle and time of application development. (3) There is no accurate basis for quantitative analysis. In xMAP technology, the fluorescence intensity of each microsphere-TM-fluorescent reporter complex can be measured, and multiple same-color The proportion of microspheres bound with fluorescent reporter molecules in the microspheres, this information can be used to analyze the content of the corresponding TM, but because the amount of cross-linked BRE in each microsphere cannot be exactly the same, according to Microsphere-TM- There will be a large error in the quantification of the fluorescence intensity of the fluorescent reporter molecular complex. Due to the randomness of sampling, the microspheres collected for each analysis are different, so the proportion of luminescent microspheres for each test cannot be exactly the same. Therefore, xMAP can only conduct quantitative analysis in a statistical sense based on the above two indicators, but cannot give a quantitative formula with direct relationship

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological molecule high flux quantitative detection method
  • Biological molecule high flux quantitative detection method
  • Biological molecule high flux quantitative detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1 Biomolecular Coding Analysis (BMCA) Method for Analyzing Nucleic Acid Fragments

[0079] Use 124bpds DNA as rBRE-CM, Escherichia coli 16S RNA genome probe as tBRE1, and 175bp ds DNA as CM 1 , with Staphylococcus aureus 16S RNA genomic probe as tBRE 2 , CM labeled with 322bp ds DNA 2 , prepared by rBRE-CM3.3ng / μl, tBRE-CM 1 3.9ng / μl, tBRE-CM 215ng / μl detection reagent. The PCR products of 16S RNA genomic DNA of Pseudomonas aeruginosa and Staphylococcus aureus were used as detection specimens. Using Agilent 2100 biochip analyzer and DNA2100 electrophoresis chip as separation and detection methods, a BMCA detection system was established to detect the PCR product of 16S RNA gene of Staphylococcus aureus.

[0080] TM: Staphylococcus aureus 16S RNA gene fragment

[0081] wxya 1 : 5′CGAACGGTAACAGGAAGAAGC3′

[0082] wxya 2 : 5′CTTCTCTGATGTTAGCGGCG3′

[0083] CM 1 : 5′CGTGGTCATCACCTCG TCAATTGGTGCGGTCTACATGGACCCGAACCGTGACCCTGAAGCCGTCGTTGACGAAAGTTGCTGGAGTGATC...

Embodiment 2

[0117] Example 2 Biomolecular Coding Analysis (BMCA) Method for Analyzing Proteins

[0118] 124bp dsDNA as rBRE-CM, Digoxigenin (Dig) as tBRE 1 , with 367bpdsDNA as CM 1 , with biotin (Bio) as tBRE 2 , with 394bp dsDNA as CM 2 , according to 2.0ng / μl rBRE-CM, 1.6ng / μl Dig-367bpdsDNA (tBRE 1 -CM 1 ) and 2.0ng / μl Bio-394bpdsDNA (tBRE 2 -CM 2 ) to form BMCA detection reagent R1, and use Agilent 2100 bioanalyzer and DNA1000 type electrophoresis chip as the separation detection method to construct the BMCA detection system.

[0119] TM: streptavidin

[0120] The following describes in detail the process of using the biomolecular coding analysis method (BMCA) to carry out the protein detection process in this embodiment:

[0121] 1. Preparation of detection reagents

[0122] (1) PCR preparation of 124bp dsDNA:

[0123] PCR primer S: 5'GACGATCCCGAGCAAAT3'

[0124] PCR Primer A: 5'GTCCATGTAGACCGCACC3'

[0125]PCR template: a fragment of a cinnamoyl-CoA reductase (CCR) gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention disclose the method of a high pass and fixed quantity detect of bimolecular, it use the method of coding molecule to achieve high pass and fixed quantity detect, it can markedly improve the efficiency of correlation application within the field of the research biology, the prove of clinic and eatable sanitation, the detect of environment and the prove of medical jurisprudence etc.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a high-throughput quantitative detection method for biomolecules. Background technique [0002] In biological research and clinical diagnosis, it is often necessary to know how many biomolecules and their contents are contained in research or clinical specimens. Before the advent of high-throughput quantitative detection methods (highthroughput detection methods), it is necessary to know how many biomolecules exist in a sample, and how many times the sample needs to be tested. The number of is often limited, it is difficult to implement too many detections, and it is extremely difficult to obtain a large amount of detection information. Therefore, high-throughput quantitative detection technology can not only greatly improve the detection efficiency of biological research and experimental diagnosis, but also greatly improve the information abundance that can be obtained ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/53G01N21/64
Inventor 蒋天伦府伟灵陈鸣
Owner GUANGZHOU BDS BIOLOGICAL TECH CO LTD