Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction

A technology of pancreatic kininogenase and composition, applied in the field of recombinant human pancreatic kininogenase pharmaceutical composition, which can solve the problems of unknown influence on enzyme activity, difficulty in collecting human urine, limited human urine protein resources, etc., and achieve side effects Small, less side effects, excellent efficacy

Active Publication Date: 2008-03-05
GUANGDONG TECHPOOL BIO-PHARMA CO LTD
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its amino acid composition is the same as the amino acid sequence of human pancreatic kininogenase, but there are Glu / Lys two amino acids at the 162 position of the kininogenase protein extracted from human urine. Effect of activity unknown
The clinical use of human urinary kininogenase found that too fast intravenous infusion would lead to adverse side effects such as a sharp drop in blood pressure, which brought certain risks to patients
In addition, it is difficult to collect human urine, and human urine protein resources are very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction
  • Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction
  • Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Cloning of human pancreatic kininogenase gene (KLK1 gene)

[0049] Materials and methods: Using human kidney total RNA as a template, the full-length cDNA of KLK was first obtained through a reverse transcription kit (Invitrogen, USA). Then using the cDNA as a template, first amplify the two fragments of 1-496bp (taking ATG as 1) and 476-789bp of KLK respectively, and then use the 5' and 3' end primers to splice the two fragments into Complete KLK gene. PCR reaction conditions for amplifying the KLK fragment: denaturation at 94°C for 3 minutes; 30s at 94°C; 30s at 62°C; 30s at 72°C; 34 cycles of amplification;

[0050] The primers used to amplify KLK 1-496 are:

[0051] Upstream primer: 5'GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGT

[0052] CCCGGATTGTGG3'

[0053] Downstream primer: 5'AATTCTCTGGTTCGATGCTGC3'

[0054] The primers used for PCR amplification of 476-789bp fragments are:

[0055] Upstream primer: 5'GCAGCATCGAACCAGAGAATTTCTC...

Embodiment 2

[0064] Embodiment 2: Contain the construction of recombinant KLK1 gene expression plasmid

[0065] The full-length KLK1 gene was inserted into the Xho I and EcoR I sites of the vector pcDNA3.1 / myc-His(-)A containing a strong CMV promoter, and the pcDNA3.1-KLK1 eukaryotic expression plasmid was constructed.

[0066] Primers used to construct pcDNA3.1-KLK1:

[0067] Upstream primer: 5'GTGA CTCGAG ACCATGGGGTTCCTGGTTCTGTGC3' (Xho I restriction site is underlined)

[0068] Downstream primer: 5'ATCT GAATTC TCAGGAGTTCTCCGCTATGGTGTC3' (the underline is the EcoR I restriction site).

[0069] In addition, in order to construct a fusion protein containing human pancreatic kininogenase and human IgG1 Fc fragment in order to express a more stable fusion protein in vivo, human IgG1 Fc fragment was inserted at the EcoR I and BamH I sites of pcDNA3.1-KLK1 to construct The pcDNA3.1-KLK1-Fc eukaryotic expression plasmid was obtained. The Fc fragment is located at the C-terminus of the KLK...

Embodiment 3

[0070] Example 3: Expression and preparation of recombinant human pancreatic kininogenase in eukaryotic cells

[0071] method:

[0072] 1. Expression of KLK1 gene in CHO cells:

[0073]CHO cells were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C with 5% CO2. The pcDNA3.1-KLK eukaryotic expression plasmid prepared in the above-mentioned embodiment 2 was transfected into CHO cells with cationic liposomes (LipofectAMINE2000, Invitrogen Company), and the transfected cells were screened with G418; then the G418 screening was identified by enzyme activity assay and Western Blot The latter monoclonal stable cell line.

[0074] 2. Large-scale culture of host cells expressing recombinant human pancreatic kininogenase:

[0075] a) The cell line containing the expressed recombinant protein is cultured with DMEM medium (pH7.20) containing 5% fetal bovine serum, and subcultured in a serum-free medium using a conventional method, and then cultured in sma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the use of recombinant human kallidinogenase composition in preparing medicine for preventing and treating cerebral infarction. The recombinant human kallidinogenase composition is prepared with recombinant human kallidinogenase through combination with the host cell expressing the recombinant protein by means of molecular biology technology. It has obvious effect of preventing and treating cerebral infarction. The recombinant human kallidinogenase composition of the present invention is normally in the form of medicine composition, such as freeze dried powder for injection or liquid injection.

Description

(1) Technical field [0001] The invention relates to a pharmaceutical composition of recombinant human pancreatic kininogenase, its preparation method and its application in pharmacy. More specifically, the present invention relates to the preparation of recombinant human pancreatic kininogenase by combining molecular biology techniques with large-scale cell culture methods, and also relates to pharmaceutical compositions containing recombinant human pancreatic kininogenase. The present invention further relates to the use of recombinant human pancreatic kininogenase in the preparation of medicines for treating and preventing cerebral infarction. (2) Background technology [0002] Human pancreatic kininogenase can act on the kininogen substrate to release kinin with vasoactive activity. The combination of kinin with specific receptors on the target organ can produce a series of biological effects, such as dilating blood vessels to increase blood flow, Improve blood circulati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/48A61K9/19A61P9/10C12N15/57
Inventor傅和亮侯永敏吴蓉蓉王晓岩
OwnerGUANGDONG TECHPOOL BIO-PHARMA CO LTD