Nucleic acid sequencing method based on fluorescence quenching

A technology of fluorescence quenching and nucleic acid sequencing, applied in the field of biomedicine, can solve the problems of large DNA damage, high cost and toxicity, and achieve the effect of simple and effective implementation.

Inactive Publication Date: 2008-04-30
SOUTHEAST UNIV
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Lu Zuhong et al proposed to prepare a high-density single-molecule multi-copy random whole-genome DNA sequencing template array for the whole genome through single-molecule multi-copy whole-genome amplification [1] , by immobilizing the rolling circle product on the carrier, on the basis of which, on-sheet extension sequencing is performed, each extension of a base has a certain fluorescence intensity, when the fluorescence intensity accumulates to a certain level, it is necessary to quench the fluorescein before further extension, and It is most suitable when no light is needed. There are foreign literatures that use laser to irradiate diphenyl iodine chloride (DPI) to quench fluorescence and then extend [2] , but the damage to DNA is relatively large, DPI drugs are expensive, toxic, and the way of light has certain limitations on high-throughput gene chip sequencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid sequencing method based on fluorescence quenching

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] 1. Template preparation: through rolling circle formation sequence

[0023] 5’-P-TAGCTAGAATCAAAAATGTTGAGTACGACGAATCTGTATGCTAATGCGGCGTGATGTATTAT

[0024] GCGTATAGAAATAATACAGA-3' and

[0025] 5'-ACCTTTATGTCAACATTTTTGATTCTAGCTATCTGTATTATTTTCACCTAGCTT-3'

[0026] The concentration is 10um and 4ul each is mixed and then denatured, and the ring is formed after natural refolding. Ligation is performed by using T4 ligase. Add probe Acry-probe (100um) 0.3ul (E3: 5'-Acry-(T) 10 ATTAGCATACAGATTCGTCGTACT-3'), through denaturation, hybridization after natural renaturation. Then add i00×BSA, dNTP, and Bst enzyme respectively, and roll the circle at 40 degrees for 30 hours.

[0027] The rolling circle products were dissolved with acrylamide gel and fixed on acrylamide gel-modified glass slides.

[0028] 2. Detection: use 1uM Cy5-probe (5'-Cy5-GCGGCGTGATGTA) to hybridize with the immobilized product [3] . After scanning, clear images with high fluorescence intensity can be obta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A nucleic acid sequencing method based on fluorescence quenching is: 1) preparing a sequencing template: the nucleic acid fragments to be sequenced, where the nucleic acid fragments include deoxyribonucleic acid, ribonucleic acid or their nucleic acid sequence amplification products, cloned products, and The product is immobilized on the carrier, 2) On-chip extension: Extend with reaction buffer, polymerase and fluorescently labeled dNTP mixture, 3) Fluorescence quenching: Use a fluorescent quencher to quench the fluorescence, 4) On-chip Extension: use reaction buffer, polymerase and fluorescently labeled dNTP mixture to extend, 5) Image recognition: use Matlab to extract feature points from the obtained extended image, remove noise points to achieve chip analysis or other commercial The optimized software directly processes the image. The invention combines nucleic acid microarray chip technology, and can perform large-scale sequencing of nucleic acids with high throughput, rapidity and low cost.

Description

technical field [0001] The invention is a nucleic acid sequencing method based on fluorescence quenching, which belongs to the genome sequencing method in the field of biomedicine. Background technique [0002] At present, it takes about tens of millions of dollars and half a year to complete the sequencing of a mammalian genome. The cost of DNA sequencing is decreasing by half every two years, but the current general-purpose DNA sequencing methods are still costly and time-consuming, far from meeting the requirements of life science and medical development, and greatly restricting the DNA sequencing market. development of. People urgently need to develop rapid and cheap individualized gene information detection technology. [0003] Lu Zuhong et al proposed to prepare a high-density single-molecule multi-copy random whole-genome DNA sequencing template array for the whole genome through single-molecule multi-copy whole-genome amplification [1] , by immobilizing the rollin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor高力吕华肖鹏峰钱正瑛陆祖宏
OwnerSOUTHEAST UNIV