Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Clone and application of rice trehalose synthase gene related with adversity resistance

A trehalose and gene technology, which is applied to trehalose synthase and its encoding gene and its application in cultivating stress-tolerant plants, can solve the problems of lack of cDNA or EST sequence experimental support, etc. promising effect

Active Publication Date: 2008-07-09
FRONTIER LAB OF SYST CROP DESIGN CO LTD
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] In addition, the exact trehalose synthase gene in rice has not been reported yet, and the prediction models of the trehalose synthase gene in different databases are also different, and there is no complete cDNA or EST sequence as experimental support

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clone and application of rice trehalose synthase gene related with adversity resistance
  • Clone and application of rice trehalose synthase gene related with adversity resistance
  • Clone and application of rice trehalose synthase gene related with adversity resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Acquisition of rice trehalose synthase gene OsTPS1 (OsTPS1Δ(1-40) and OsTPS1Δ(1-130)) related to stress tolerance

[0041] 1. Isolation and functional study of OsTPS1

[0042] Search the TIGR database, Huadade BGI database, and some other comprehensive databases such as NCBI to obtain the deduced coding sequence of TPS1. According to the prediction, its N-terminal extension region has about 128 amino acids, and there are three methionine (Met) in this region. ), we designed the 5' end primers starting with these three methionines respectively:

[0043] f001: 5' > CACCATGCCGACCCCCCGCGCC > 3'

[0044] f121: 5' > CACCATGCTCCGCGGGGAGTG > 3'

[0045] f393: 5' > CACCATGGGGATGAAGCAGCGCCTC > 3'

[0046] The 3' end primer sequence is r2958: 5'>GTCGACCTGCCTATCCAAGAACATG>3'

[0047] Extract the total RNA of Guangluai No. 4 rice at the filling stage, obtain cDNA by reverse transcription, use primer pair f001 and r2958 to amplify the full-length OsTPS1 gene by RT-PCR ...

Embodiment 2

[0049] Example 2. Obtaining of rice and stress tolerance-related trehalose synthase gene OsTPS1 (OsTPS1Δ(1-40) and OsTPS1Δ(1-130)) transgenic rice

[0050] We selected genes with N-terminal deletions of 40 and 130 amino acid residues to construct OsTPS1Δ(1-40) and OsTPS1Δ(1-130) to transform rice to detect the effects of different deleted gene fragments on rice stress tolerance. Using Agrobacterium-mediated transformation of rice, the specific method is as follows:

[0051] 1) Transformation of Agrobacterium

[0052] The recombinant plasmids pENTER-TOPO-OsTPS1Δ (1-40) and pENTER-TOPO-OsTPS1Δ (1-130) constructed in Example 2 were introduced into the plant expression vector pH2GW7 (Gateway of Invitrogen Company) by LR reaction respectively. TW vector carrier), the LR reaction system is 0.5μl Gateway  LR Clonase TM Enzyme Mix (Gateway  LR Clonase TMProvided in Enzyme Mix kit, Invitrogen), 1μl 5×buffer, 2μlpENTER-TOPO-OsTPS1Δ(1-40)(150ng / μl) or pENTER-TOPO-OsTPS1Δ(1-130)(...

Embodiment 3

[0058] Example 3, Identification of Drought Tolerance of OsTPS1Δ(1-40) and OsTPS1Δ(1-130) Transgenic Rice T1 Generation Plants

[0059]The pH2GW7-OsTPS1Δ(1-40) and pH2GW7-OsTPS1Δ(1-130) T1 transgenic rice seeds were harvested. Soak the seeds in water for 3 days to germinate them, then use 50 mg / L hygromycin for resistance screening, and use non-transgenic rice Zhonghua 11 as a control. After 5 days of screening, all the control plants died, and counted the resistant seedlings and dead seedlings of the transgenic plants To analyze the resistance segregation ratio of transgenic plants, obtain pH2GW7-OsTPS1Δ(1-40) and pH2GW7-OsTPS1Δ(1-130) transgenic lines with single point insertion, and perform Southern blot analysis to further identify the exogenous insertion gene copy number. Five different single-copy transgenic lines were selected for each gene, and the transgenic positive seedlings were subjected to drought treatment after continuing to culture for 10 days. At the same ti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a TPS gene which is derived from rice and related with stress tolerance, which encodes following proteins: firstly, an amino acid sequence with SEQ ID NO: 1 in the table or the amino acid sequence whose N-end is lack of 1-130 amino acid residues and secondly the amino acid sequence in the first step encodes derivative proteins with the function of regulating plant stress tolerance after substitution or deletion or addition of 1-10 amino acid residues. Experiments show that the tolerance of the rice to adversity stress can be increased through transforming the gene of the invention to the rice and the normal growth and the economy deseription of the rice are not affected by the gene clearly. The proteins and encoding genes has great theoretical and practical significance for researching plant stress tolerance mechanism, increasing plant stress tolerance, and improving relative deseription and will play an important role in improving plant (especially cereal crops) stress tolerance gene engineering with broad application prospects.

Description

technical field [0001] The invention relates to genes and applications related to stress tolerance in plants, in particular to trehalose synthase and its encoding gene derived from rice and its application in cultivating stress-tolerant plants. Background technique [0002] Trehalose (trehalose: α-D-glucopyranosyl-α-D-glucopyranoside) is a very stable non-reducing disaccharide formed by combining two glucose molecules through the hemiacetal hydroxyl group. It is widely found in bacteria and yeast. , fungi, algae, insects and lower animals and plants. In recent years, it has also been found in higher plants. [0003] Trehalose was originally considered as a storage sugar as a carbon source for organism metabolism, but later it was found that its more important role is an important product of stress response. Many organisms synthesize and accumulate trehalose when they are in adverse growth environments such as high temperature, dryness, high osmotic pressure, heavy metals, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N15/82C12N15/65C12N9/00A01H1/00
Inventor 王喜萍
Owner FRONTIER LAB OF SYST CROP DESIGN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com