Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice bZIP and application of the same in improving stress tolerance of plants

A gene and plant technology, applied in the application field of bZIP transcription factors and their coding genes in the cultivation of stress-tolerant plants, achieving the effect of broad application prospects

Active Publication Date: 2008-07-16
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF0 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few studies on the functions of bZIP family members that have been isolated in rice. Most of the existing data only speculate that these genes may be involved in certain growth and development processes (such as regulation of seed development) or in response to external stimuli without direct experimental evidence for an associated function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice bZIP and application of the same in improving stress tolerance of plants
  • Rice bZIP and application of the same in improving stress tolerance of plants
  • Rice bZIP and application of the same in improving stress tolerance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, acquisition of stress tolerance gene

[0037] Isolation of OsbZIP52, OsbZIP71 and OsbZIP73 genes

[0038] Search the TIGR database, Huada BGI database, and other comprehensive databases such as NCBI to obtain the predicted coding sequences of the three genes, and design 5' primers starting from the coding start site ATG of the three genes, and stop at the codon Design 3' end primers:

[0039] 5' end primer

[0040] OsbZIP52: CACCACAAAAATGGGTCGGAGGAAGGCGATGATG

[0041] OsbZIP71: CACCACAAAATGTCGAGTGGGACCTCGTCCGGG

[0042] OsbZIP73: CACCACAAAATGCTGCACCACCATTACCATGGC

[0043] 3' end primer

[0044] OsbZIP52: AGGCCACACATCAGCCGAGCAGCT

[0045] OsbZIP71:GAAGCACTGGTACTGGTACAAGTC

[0046] OsbZIP73: AATATTCTCGCATGGCTGTGAGGA

[0047]The total RNA of Guangluai No. 4 rice at the filling stage was extracted, cDNA was obtained by reverse transcription, and the full-length gene was amplified by RT-PCR method with three pairs of primers. The gene sizes of OsbZIP52,...

Embodiment 2

[0049] Example 2. Acquisition of transgenic rice related to stress tolerance OsbZIP52 / OsbZIP71 / OsbZIP73 in rice

[0050] The gene OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance obtained in Example 1 was transformed into rice by the Agrobacterium-mediated method, and the specific method was as follows:

[0051] 1) Transformation of Agrobacterium

[0052] The OsbZIP52 / OsbZIP71 / OsbZIP73 gene in the recombinant plasmid pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 constructed in Example 1 was recombined into the expression vector pH2GW7 by LR reaction, and the LR reaction system was 2 μl buffer, 2 μl (150-300ng ) linearized pH2GW7 plasmid DNA, 2 μl (100-300ng) pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 plasmid DNA, 2 μl H 2 O, then add 2 μl LR Clonase, the LR reaction condition is 25°C water bath for 1h, add 1 μl 2U / μl proteinase K, 37°C water bath for 10min. Then, the above-mentioned recombinant vector was transformed into Escherichia coli (E.coli) DH5α competent cel...

Embodiment 3

[0057] Embodiment 3, transgenic T 1 Drought Tolerance Identification of Progeny Plants

[0058] Harvest OsbZIP73 / OsbZIP71 / OsbZIP52T 1Genetically modified rice seeds. Soak the seeds in water for 3 days to germinate them, then use 50 mg / L hygromycin for resistance screening, and use non-transgenic rice Zhonghua 11 as a control. After 5 days of screening, all the control plants died, and counted the resistant seedlings and dead seedlings of the transgenic plants To analyze the resistance segregation ratio of transgenic plants, select the line with the segregation ratio of resistant seedlings and non-resistant seedlings about 3:1, the results showed that OsbZIP73 / OsbZIP71 / OsbZIP52 T 1 The transgenic lines were further cultured for one week and then subjected to drought treatment, and non-transgenic rice Zhonghua 11 plants were set as a control. Paddy rice seedling is planted in the soil of boxing, adopts vermiculite: the mixed soil of nutrient soil mixing ratio is 3: 1, and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of bZIP genes which are derived from rice and are related with stress tolerance, the encoded protein has one of the following amino acid sequences: 1) the SEQ ID No:1, 3 or 5 in a sequence table; 2) the amino acid residue sequence of the SEQ ID No:1, 3 or 5 in the sequence table is treated with the substitution, deletion or adding of one to ten amino acid residues and the derived protein has the effect of regulating the performance of plant stress tolerance. The experiments proves that the transgenic rice of the invention can improve the tolerance of the rice to high-salt, drought and low-temperature adversity threats and have no apparent impacts on the normal growth and the economic traits of the rice. The protein and the encoded genes of the invention have important theoretical and practical significances on the research of a plant stress tolerance mechanism, the improvement of the plant stress tolerance and the improvement of the related traits, thereby playing an important role in the stress tolerance genetic engineering improvement of plants (more particularly cereal crops) and having broad application prospect.

Description

technical field [0001] The invention relates to genes related to plant stress tolerance and applications thereof, in particular to the application of bZIP-like transcription factors related to stress tolerance derived from rice and their coding genes in cultivating stress-tolerant plants. Background technique [0002] Transcription factors, as direct regulators of gene expression, play an important role in the development and physiological processes of various organisms. Usually, after the organism receives various internal and external stimuli, it first regulates the expression level changes of transcription factors, and finally causes the expression changes of effector target genes, which is then manifested as the body's response. Among the numerous transcription factor families, several families of transcription factors co-exist in plants and animals, including the bZIP (basic leucine zipper) family. This family has a large number of genes and diverse structures, but the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N15/65C07K14/415A01H1/00
Inventor 王喜萍
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com