Rice bZIP and application of the same in improving stress tolerance of plants
A gene and plant technology, applied in the application field of bZIP transcription factors and their coding genes in the cultivation of stress-tolerant plants, achieving the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, acquisition of stress tolerance gene
[0037] Isolation of OsbZIP52, OsbZIP71 and OsbZIP73 genes
[0038] Search the TIGR database, Huada BGI database, and other comprehensive databases such as NCBI to obtain the predicted coding sequences of the three genes, and design 5' primers starting from the coding start site ATG of the three genes, and stop at the codon Design 3' end primers:
[0039] 5' end primer
[0040] OsbZIP52: CACCACAAAAATGGGTCGGAGGAAGGCGATGATG
[0041] OsbZIP71: CACCACAAAATGTCGAGTGGGACCTCGTCCGGG
[0042] OsbZIP73: CACCACAAAATGCTGCACCACCATTACCATGGC
[0043] 3' end primer
[0044] OsbZIP52: AGGCCACACATCAGCCGAGCAGCT
[0045] OsbZIP71:GAAGCACTGGTACTGGTACAAGTC
[0046] OsbZIP73: AATATTCTCGCATGGCTGTGAGGA
[0047]The total RNA of Guangluai No. 4 rice at the filling stage was extracted, cDNA was obtained by reverse transcription, and the full-length gene was amplified by RT-PCR method with three pairs of primers. The gene sizes of OsbZIP52,...
Embodiment 2
[0049] Example 2. Acquisition of transgenic rice related to stress tolerance OsbZIP52 / OsbZIP71 / OsbZIP73 in rice
[0050] The gene OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance obtained in Example 1 was transformed into rice by the Agrobacterium-mediated method, and the specific method was as follows:
[0051] 1) Transformation of Agrobacterium
[0052] The OsbZIP52 / OsbZIP71 / OsbZIP73 gene in the recombinant plasmid pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 constructed in Example 1 was recombined into the expression vector pH2GW7 by LR reaction, and the LR reaction system was 2 μl buffer, 2 μl (150-300ng ) linearized pH2GW7 plasmid DNA, 2 μl (100-300ng) pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 plasmid DNA, 2 μl H 2 O, then add 2 μl LR Clonase, the LR reaction condition is 25°C water bath for 1h, add 1 μl 2U / μl proteinase K, 37°C water bath for 10min. Then, the above-mentioned recombinant vector was transformed into Escherichia coli (E.coli) DH5α competent cel...
Embodiment 3
[0057] Embodiment 3, transgenic T 1 Drought Tolerance Identification of Progeny Plants
[0058] Harvest OsbZIP73 / OsbZIP71 / OsbZIP52T 1Genetically modified rice seeds. Soak the seeds in water for 3 days to germinate them, then use 50 mg / L hygromycin for resistance screening, and use non-transgenic rice Zhonghua 11 as a control. After 5 days of screening, all the control plants died, and counted the resistant seedlings and dead seedlings of the transgenic plants To analyze the resistance segregation ratio of transgenic plants, select the line with the segregation ratio of resistant seedlings and non-resistant seedlings about 3:1, the results showed that OsbZIP73 / OsbZIP71 / OsbZIP52 T 1 The transgenic lines were further cultured for one week and then subjected to drought treatment, and non-transgenic rice Zhonghua 11 plants were set as a control. Paddy rice seedling is planted in the soil of boxing, adopts vermiculite: the mixed soil of nutrient soil mixing ratio is 3: 1, and the...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com