Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method
A technology of Cryptosporidium parvum and detection kit, which is applied in the direction of microbial determination/inspection, biochemical equipment and methods, and resistance to vector-borne diseases. It can solve the problems of low specificity and sensitivity, time-consuming and labor-intensive detection rate, To achieve the effect of strong specificity, accurate and objective result judgment, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Cryptosporidium-specific diagnostic sequence: the conserved part of the sequence of the 18SrRNA gene (this gene is shared by all species of Cryptosporidium and has the smallest gene variation among species), compared to multiple Cryptosporidium in NCBI The species are shared, and the homology is greater than 98%, meeting the genus-specific detection criteria.
[0056] attggaggttgttccttactccttcagcacccttatgagaaatcaaagtctttgggttctagggggagtat
[0057] ggtcgcaaggctgaaacttaaaggaattgacggaagggcaccaccaggagtggagcctgcggcttaatttg
[0058] actcaacacgggaaaactcaccaggtccagacataggaaggattgacagattgatagctccttcttgatt
[0059] ctatggggcggct
[0060] Species-specific diagnostic sequence of Cryptosporidium parvum: a finger-shaped U1 nuclear small molecule ribonucleoprotein gene, which is only shared by human and Cryptosporidium parvum in NCBI comparison, with 100% homology, in line with species-specific detection research standard.
[0061] taagaagccaccaagaaggcggaaggcacaactataatttaagaaagtt...
Embodiment 2
[0068] Specific diagnostic primers were designed according to the Cryptosporidium genus-specific and species-specific diagnostic sequences of Example 1 as follows:
[0069] Genus-specific diagnostic primer: CF: 5'-ATTGGAGGTTGTTCCTTACTCCT-3'
[0070] CR: 5'-AGCCGCCCATAGAATCAAGAA-3'
[0071] Species specific diagnostic primer: HF: 5'-TAAGAAGCCACCAAGAAGGCG-3'
[0072] HR: 5'-TCAATAGGCTTAAATGGGTTCGGGA-3
[0073] The above two primers can simultaneously amplify species-specific and genus-specific diagnostic gene fragments in the same system (duplex PCR), with bright target bands and no non-specific bands. The purpose of simultaneously detecting Cryptosporidium and Cryptosporidium is realized.
Embodiment 3
[0075] Cryptosporidium and Cryptosporidium parvum PCR detection kit, the composition and structure are as follows:
[0076] (1) DNA lysis solution: a mixed solution containing different concentrations of NaCl, Tris-HCl, EDTA, SDS and proteinase K. The ratio of each concentration is: NaCl 100 mM, Tris-HCl (pH 7.5) 20 Mm, EDTA 25 Mm, SDS 2% (w / v) and proteinase K 0.1 μg / μl. The role of the lysate is to lyse the oocyst and digest the proteins within, releasing the genomic DNA.
[0077] (2) PCR reaction solution: 4 kinds of dNTPs with a final concentration of 100-300 μM each, primers CF, CR, HF and HR with a final concentration of 10-100 pmol / μl, and Mg with a final concentration of 1.5-4.5 mM 2+ concentration. Add 2.0 U of Taq enzyme to each PCR reaction (20 μl), and the reaction solution does not contain Taq enzyme.
[0078] (3) Cryptosporidium and Cryptosporidium parvum species-specific primers
[0079] (4) Positive control: the positive control used in the kit of the prese...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 