Test paper strip for detecting cleptospira colloidal gold, method for making same and applications
A leptospirosis and detection test paper technology, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems that the detection time cannot meet the rapid screening, high technical requirements, and cannot handle a large number of problems, so as to achieve timely control of the epidemic, The results are clear and easy to distinguish, and the effect of saving manpower and material resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Cloning and expression of Leptospira specific antigen LipL32
[0049] (1) Amplification of the LipL32 (Accession No. AM936999) gene
[0050] Design primers based on the sequence of the target gene fragment:
[0051] LipL32 primer sequence
[0052] 5'GCCGAATTCATGAAAAAACTTTCGATTTTG 3'
[0053] 5'GCCCTCGAGTTACTTAGTCGCGTCAGAAGC 3'
[0054] PCR parameters: 95°C for 5min, 95°C for 1min, 50°C for 30s, 70°C for 1min, 30 cycles. Finally, extend at 70°C for 10 min.
[0055] (2) Cloning of the target gene and screening of positive recombinants
[0056] After electrophoresis, the two PCR amplification products were recovered by gel cutting, ligated with the PMD-18T cloning vector at 16°C overnight, and then transformed into DH5a competent cells. The monoclonal strain was picked and cultured overnight at 37°C. After the plasmid was extracted, the plasmid Use PCR as a template to identify positive clones and determine the sequence.
[0057] (3) Construction of fusion...
Embodiment 2
[0065] Example 2 Preparation of Leptospira Specific Antigen LipL32 Polyclonal Antibody
[0066] (1) Animal immunity:
[0067] New Zealand white rabbits of 1-2 kg were selected, and the Leptospira-specific antigen LipL32 protein was injected subcutaneously at multiple points on the back, and the immunization dose was 0.5-1 mg / kg. A total of 3 to 5 times of immunization.
[0068] (2) Immunological titer detection:
[0069] Coat the Leptospira-specific antigen LipL32 protein microtiter plate, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, the serum can be collected.
[0070] (3) Antibody purification and verification:
[0071] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity was tested by ELISA, and the titer was greater than 1:20000.
Embodiment 3
[0072] Example 3 Preparation of Leptospira Specific Antigen LipL32 Monoclonal Antibody
[0073] (1) Immunized mice
[0074] After the genetically engineered antigen was taken out from the -20°C low-temperature refrigerator and dissolved, it was subcutaneously injected into the back of BALB / C mice (0.2ml / mouse), with an interval of 10 days. Three days before the fusion, mice were challenged with 0.15 ml of antigen in the peritoneal cavity. The immune effect was detected by ELISA method.
[0075] (2) Myeloma cells
[0076] SP2 / 0 myeloma cells: Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours. Uniform, neatly arranged, logarithmically split, ready for fusion.
[0077] (3) cell fusion
[0078] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weigh...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com