Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for detecting cleptospira colloidal gold, method for making same and applications

A leptospirosis and detection test paper technology, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems that the detection time cannot meet the rapid screening, high technical requirements, and cannot handle a large number of problems, so as to achieve timely control of the epidemic, The results are clear and easy to distinguish, and the effect of saving manpower and material resources

Active Publication Date: 2012-08-15
辽宁迪浩生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] The above operations need to be carried out by professional technicians in professional laboratories. The technical requirements are high, the equipment is relatively expensive, and it is impossible to handle a large number of suspicious specimens, and the purpose of rapid screening cannot be achieved in terms of detection time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting cleptospira colloidal gold, method for making same and applications
  • Test paper strip for detecting cleptospira colloidal gold, method for making same and applications
  • Test paper strip for detecting cleptospira colloidal gold, method for making same and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Cloning and expression of Leptospira specific antigen LipL32

[0049] (1) Amplification of the LipL32 (Accession No. AM936999) gene

[0050] Design primers based on the sequence of the target gene fragment:

[0051] LipL32 primer sequence

[0052] 5'GCCGAATTCATGAAAAAACTTTCGATTTTG 3'

[0053] 5'GCCCTCGAGTTACTTAGTCGCGTCAGAAGC 3'

[0054] PCR parameters: 95°C for 5min, 95°C for 1min, 50°C for 30s, 70°C for 1min, 30 cycles. Finally, extend at 70°C for 10 min.

[0055] (2) Cloning of the target gene and screening of positive recombinants

[0056] After electrophoresis, the two PCR amplification products were recovered by gel cutting, ligated with the PMD-18T cloning vector at 16°C overnight, and then transformed into DH5a competent cells. The monoclonal strain was picked and cultured overnight at 37°C. After the plasmid was extracted, the plasmid Use PCR as a template to identify positive clones and determine the sequence.

[0057] (3) Construction of fusion...

Embodiment 2

[0065] Example 2 Preparation of Leptospira Specific Antigen LipL32 Polyclonal Antibody

[0066] (1) Animal immunity:

[0067] New Zealand white rabbits of 1-2 kg were selected, and the Leptospira-specific antigen LipL32 protein was injected subcutaneously at multiple points on the back, and the immunization dose was 0.5-1 mg / kg. A total of 3 to 5 times of immunization.

[0068] (2) Immunological titer detection:

[0069] Coat the Leptospira-specific antigen LipL32 protein microtiter plate, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, the serum can be collected.

[0070] (3) Antibody purification and verification:

[0071] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity was tested by ELISA, and the titer was greater than 1:20000.

Embodiment 3

[0072] Example 3 Preparation of Leptospira Specific Antigen LipL32 Monoclonal Antibody

[0073] (1) Immunized mice

[0074] After the genetically engineered antigen was taken out from the -20°C low-temperature refrigerator and dissolved, it was subcutaneously injected into the back of BALB / C mice (0.2ml / mouse), with an interval of 10 days. Three days before the fusion, mice were challenged with 0.15 ml of antigen in the peritoneal cavity. The immune effect was detected by ELISA method.

[0075] (2) Myeloma cells

[0076] SP2 / 0 myeloma cells: Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours. Uniform, neatly arranged, logarithmically split, ready for fusion.

[0077] (3) cell fusion

[0078] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weigh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a colloidal gold test strip for the detection of Leptospira. A monoclonal antibody of Leptospira specific antigen LipL32 or polyclonal antibody of anti Leptospira specific antigen, and a quality control double-antibody IgG coat a nitrate cellulose film (NC film), and a membrane chromatography double antibody sandwich method is adopted to detect the leptospira in a specimen in combination with a monoclonal antibody of colloidal gold labeled Leptospira specific antigen LipL32. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, large scale site detection of an accident and epidemiological investigation, and has auxiliary effect on the diagnosis of leptospira infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a leptospira colloidal gold detection test strip, a preparation method and an application thereof. Background technique [0002] Leptospirosis (Leptospinosis, referred to as Leptospirosis) is an acute infectious disease caused by pathogenic Leptospira (abbreviated as Leptospira). Rodents, pigs and other livestock are the main sources of infection. Contact with wild animals and domestic animals carrying bacteria, Leptospira enters the human body through the skin of the exposed part and acquires a zoonotic infection. The onset is mostly in the summer and autumn rice harvesting season or after heavy rain and flood. After a person is infected with leptospirosis, the incubation period is usually 1 to 3 weeks. First, sepsis is formed, which may have various clinical manifestations, including common type, pulmonary hemorrhage type, icteric hemorrhage type, and meningoe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com