Bacillus coli-mycobacteria shuttling expression plasmid vector and its application in preparation of pathogenic microorganism vaccine

A technology of pathogenic microorganisms and Escherichia coli, applied in the direction of using vectors to introduce foreign genetic material, applications, biochemical equipment and methods, etc., can solve the problems of rising TB morbidity and mortality

Inactive Publication Date: 2009-06-10
SHENZHEN CENT FOR DISEASE CONTROL & PREVENTION +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the emergence of drug-resistant strains of Mycobacterium tuberculosis and the prevalence of AIDS caused by HIV, the morbidity and mortality of TB have increased significantly, and the effect of BCG, a traditional vaccine, has been severely challenged.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus coli-mycobacteria shuttling expression plasmid vector and its application in preparation of pathogenic microorganism vaccine
  • Bacillus coli-mycobacteria shuttling expression plasmid vector and its application in preparation of pathogenic microorganism vaccine
  • Bacillus coli-mycobacteria shuttling expression plasmid vector and its application in preparation of pathogenic microorganism vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Construction of the Escherichia coli-mycobacterium shuttle vector plasmid pBCG-X suitable for secreting and expressing pathogenic microorganism antigens

[0042] Materials: Escherichia coli-mycobacterium shuttle expression plasmid pBCG-2000, see: Huangpu Yongmu, Cheng Jizhong, etc., Research on the Expression of Foreign Genes in BCG, Journal of Biochemistry, 1997, 13: 370-373.

[0043] 1. Amplification and insertion of Mycobacterium tuberculosis hsp60 promoter into pBCG-2000

[0044] Using the genomic DNA of the standard strain of Mycobacterium tuberculosis H37Rv (GenBank accession number NC_009525) as a template, the primers for PCR amplification of the upstream regulatory sequence of heat shock protein 60 (hsp60) were designed as follows:

[0045] 5' CCGCGG TCGAACGAGGGGCAT3' (the underline is the SacI restriction site)

[0046] 5'TCTAGACATTGCGAAGTGATTCCTCCGGATCG3' (XbaI restriction site is underlined)

[0047] The hsp60 promoter region was amplified by ...

Embodiment 2

[0060] Example 2: Construction of Toxoplasma gondii recombinant BCG-GRA8 vaccine and its immune experiment analysis

[0061] Toxoplasma gondii has a wide range of host sources and numerous isolates. Screening new candidate antigen molecules with strong immunogenicity and specificity, high stability and conservation is the prerequisite for the development of effective diagnostic antigens and practical vaccines. The present invention takes GRA8 as the target antigen, constructs the recombinant BCG vaccine with BCG as the carrier, analyzes its immune response, and observes its protective effect against toxoplasma gondii infection.

[0062] 1. Main experimental materials:

[0063] 1. Animals, cell lines and plasmids 6-8-week-old SPF female BALB / c mice were purchased from the Experimental Animal Center of Sun Yat-sen University School of Medicine; E.coli DH5a was purchased from OMEGA Biotechnology Company, Mycobacterium smegmatis M. smegmatic mc 2 155, from ATCC; pGEM-T carrier, ...

Embodiment 3

[0148] Example 3: Establishment of recombinant Mycobacterium smegmatis vaccine strain expressing SARS virus M protein and its immunogenicity analysis

[0149] This embodiment selects Mycobacterium smegmatis M.smegmatis mc 2 155 as a vaccine vector to construct recombinant Msmc expressing M protein 2 155-M vaccine and analyze its immunogenicity.

[0150] 1. Materials and methods

[0151] 1.1 Materials

[0152] 1.1.1 Animals, cell lines and plasmids

[0153] 6-8-week-old SPF female BALB / c mice were purchased from the Experimental Animal Center of Sun Yat-sen University School of Medicine; E.coli DH5a was purchased from OMEGA Biotechnology Company, Mycobacterium smegmatis M.smegmatic mc 2155, from ATCC; pGEM-T carrier, the product of Promega Company; pMD18-M-TA recombinant plasmid was constructed by the inventor (Lei Mingjun, Wu Shaoting, Dai Wuxing, etc. Cloning and expression of full-length gene of SARS coronavirus M protein and purification. Chinese Journal of Zoonotic Di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an Escherichia coli-mycobacterium shuttle vector plasmid suitable for secretory expression of pathogenic microorganism antigen and application thereof to preparation of a pathogenic microorganism vaccine. The Escherichia coli-mycobacterium shuttle vector plasmid is constructed based on an Escherichia coli-mycobacterium shuttle vector plasmid pBCG-2000; a modified mycobacterium tuberculosis heat shock protein 60 promoter regulation sequence with SEQ ID NO.1 as the sequence is inserted; a T4 transcription termination sequence which is artificially synthesized and has the sequence of SEQ ID NO.2 is inserted; a modified signal peptide sequence, with SEQ ID NO.3 as the sequence, of a BCG antigen gene 85b is inserted; and an artificial synthetic sequence with SEQ ID NO.4 as the sequence is added. The Escherichia coli-mycobacterium shuttle vector plasmid can be applied to the research of recombinant vaccines of resisting Toxophasma gondii, SARS coronaviruses and tubercle bacillus.

Description

technical field [0001] The invention relates to a new carrier plasmid and its application in preparing pathogenic microorganism vaccines. Background technique [0002] Vaccine is currently the only weapon that humans can completely control an infectious disease. Vaccination not only protects individuals from the invasion of infectious disease pathogens, but also limits the spread of pathogenic microorganisms in the population. Live vaccines using viruses and bacteria as carriers is a development trend in the field of vaccine research. The principle is to insert foreign target genes into the genome of existing virus or bacterial vaccine strains (such as vaccinia, BCG) or certain parts of their plasmids for use. High expression, but does not affect the survival and reproduction of the vaccine strain. After inoculation of this recombinant vaccine, in addition to the protection against the original virus (or bacteria), it also obtains protection against diseases related to the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/30C12N15/50C12N15/31A61K48/00A61P33/02A61P31/06A61P31/14
Inventor吴少庭秦莉甘燕袁仕善刘洪波王芳李俊华
OwnerSHENZHEN CENT FOR DISEASE CONTROL & PREVENTION