Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof

An African swine fever virus, fluorescent quantitative technology, applied in the field of African swine fever virus fluorescent quantitative PCR detection reagents and its preparation, can solve the problems of reduced accuracy and sensitivity, high experimental cost, high synthesis technology requirements, etc., and achieve high accuracy , highly specific effects

Inactive Publication Date: 2009-06-24
ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the former, the fluorescence value is often affected by linear amplification products (extended from one side of the primer to the end) and primer dimers (Chen Y J, HU C J and ZhaoM Q. Construction of realtime quantitative polymerase chain reaction platform with SYBRGreenI(J) .Practical Journal of Medicine & Pharmacy, 2004, 21(11): 997~999), thereby reducing the accuracy and sensitivity of quantification
The TaqMan probe is superior to the former in terms of quantitative sensitivity, but there are deficiencies in probe design, high technical requirements for synthesis and high experimental cost.
Scott M Reidb and Geoffrey H established a real-time fluorescent quantitative PCR detection technology in 2003 with ASFV VP72 as the target gene, combining fluorescent probes with PCR methods to make the experiment more rapid, sensitive and convenient, and can be used for rapid detection of suspected African pigs P54 is an effective method for differential diagnosis (King DP, Reid SM.J VirolMethods, 2003, 107(1): 53-61), but the fluorescent quantitative PCR technology for the P54 gene is still unavailable both at home and abroad. no report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof
  • African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof
  • African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043] The preparation method of described African swine fever virus fluorescent quantitative PCR detection reagent may further comprise the steps:

[0044] (1) Select the conservative fragment of the P54 gene sequence of African swine fever virus as the target, and the amplification target nucleotide sequence of its gene fragment is as shown in SEQ ID NO.1, which is:

[0045] GCAATGGGCAGAAGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGCGACTACAGCAAGT

[0046] GCAGGCAAACCAGTCACGGGCAGACCGGCAACAAACAGACCAGCAACAAACAAACCAGTCACGG

[0047] ACAACCCAGTTACGGACAGACTAGTCATGGCAACTGGCGGGCCAGCGGCCGCACCTGCGGCCGC

[0048] GAGTGCTCATCCGACTGAGCCTTACAC;

[0049] (2) Design primers and probes according to the characteristics of the P54 gene and the design principles of primers and probes;

[0050] (3) The synthesis of the probe is simultaneously fluorescently labeled at both ends, the fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3'...

Embodiment 1

[0062] Example 1 Extraction of African swine fever virus DNA

[0063] The African swine fever virus DNA used in the invention was donated by Institut zooprofilatticsperimenTALE DELLA SARDEGNA, Italy, and the virus DNA was extracted according to the instructions of the Roche spin column DNA extraction kit.

Embodiment 2

[0064] Example 2 Design and synthesis of ASFV P54 gene PCR amplification primers and Taqman detection primers and probes

[0065] According to the GenBank ASFV P54 gene sequence (GenBank accession number: DQ028323), primers containing BamHI and XhoI restriction sites and protective bases were designed and synthesized to amplify the 552bp fragment of the full sequence of P54. The primer sequences are as follows:

[0066] pET-P54-1:5,-GC GGATCC AATGGATTCTGAAT-3' (the horizontal line indicates the introduced BamHI restriction site)

[0067] DET-P54-2: 5'-AG CTCGAG CAAGGAGTTTTCTA-3' (the crossed line indicates the introduced XhoI restriction site)

[0068] According to the GenBank ASFV P54 gene sequence (GenBank accession number: DQ028323), design and synthesize specific primers and Taqman probes to detect P54. The probe fluorescent group is FAM, the quencher group is TAMRA, the probe and primer sequences as follows:

[0069] ASFV P54-probe: 5'-FAM-AGTGCAGGCAAACCAGTCACGGGCA-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescence quantitative PCR detection reagent for African swine fever virus, and a preparation method and the application thereof. A set of specific primers and Taqman probes are designed and synthesized to be used for detecting ASFV P54 in relevant porcine products. A standard curve drawn in the invention provides a standard for the quantitative detection of ASFV P54. The invention establishes a fast and simple real-time fluorescence quantitative PCR detection system with strong specificity and high flexibility. The detection time is only several hours, and the detection lower limit can be 15 copies. The invention can be applied to the diagnosis and quarantine technology towards the imported relevant porcine products at port, and the invention provides reliable and effective technical condition for the import quarantine work of the country without ASF.

Description

technical field [0001] The invention belongs to the field of animal pathogen detection, in particular to a biological agent designed with African swine fever gene fragments as the target, using real-time fluorescence quantitative PCR (real-time fluorescence quantitative PCR) technology to detect African swine fever virus (African swine fever virus, The method for the P54 gene in ASFV), that is, the African swine fever virus fluorescent quantitative PCR detection reagent and its preparation method and application. Background technique [0002] African swine fever (ASF) is an acute, febrile, highly contagious infectious disease of pigs caused by African swine fever virus (ASFV). It is characterized by a short course of disease and a high fatality rate, which can be as high as 100%. The clinical symptoms and pathological changes are similar to acute swine fever, and it is easy to be misdiagnosed during diagnosis. (William, Hess Adv.African swine fever: a reassessment[J].Vet Sc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 董志珍侯艳梅赵祥平李琳陈本龙肖妍黄金海张霞
Owner ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com