African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof
An African swine fever virus, fluorescent quantitative technology, applied in the field of African swine fever virus fluorescent quantitative PCR detection reagents and its preparation, can solve the problems of reduced accuracy and sensitivity, high experimental cost, high synthesis technology requirements, etc., and achieve high accuracy , highly specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0043] The preparation method of described African swine fever virus fluorescent quantitative PCR detection reagent may further comprise the steps:
[0044] (1) Select the conservative fragment of the P54 gene sequence of African swine fever virus as the target, and the amplification target nucleotide sequence of its gene fragment is as shown in SEQ ID NO.1, which is:
[0045] GCAATGGGCAGAAGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGCGACTACAGCAAGT
[0046] GCAGGCAAACCAGTCACGGGCAGACCGGCAACAAACAGACCAGCAACAAACAAACCAGTCACGG
[0047] ACAACCCAGTTACGGACAGACTAGTCATGGCAACTGGCGGGCCAGCGGCCGCACCTGCGGCCGC
[0048] GAGTGCTCATCCGACTGAGCCTTACAC;
[0049] (2) Design primers and probes according to the characteristics of the P54 gene and the design principles of primers and probes;
[0050] (3) The synthesis of the probe is simultaneously fluorescently labeled at both ends, the fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3'...
Embodiment 1
[0062] Example 1 Extraction of African swine fever virus DNA
[0063] The African swine fever virus DNA used in the invention was donated by Institut zooprofilatticsperimenTALE DELLA SARDEGNA, Italy, and the virus DNA was extracted according to the instructions of the Roche spin column DNA extraction kit.
Embodiment 2
[0064] Example 2 Design and synthesis of ASFV P54 gene PCR amplification primers and Taqman detection primers and probes
[0065] According to the GenBank ASFV P54 gene sequence (GenBank accession number: DQ028323), primers containing BamHI and XhoI restriction sites and protective bases were designed and synthesized to amplify the 552bp fragment of the full sequence of P54. The primer sequences are as follows:
[0066] pET-P54-1:5,-GC GGATCC AATGGATTCTGAAT-3' (the horizontal line indicates the introduced BamHI restriction site)
[0067] DET-P54-2: 5'-AG CTCGAG CAAGGAGTTTTCTA-3' (the crossed line indicates the introduced XhoI restriction site)
[0068] According to the GenBank ASFV P54 gene sequence (GenBank accession number: DQ028323), design and synthesize specific primers and Taqman probes to detect P54. The probe fluorescent group is FAM, the quencher group is TAMRA, the probe and primer sequences as follows:
[0069] ASFV P54-probe: 5'-FAM-AGTGCAGGCAAACCAGTCACGGGCA-...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
