Bt protein Cry52Bal as well as encoding gene thereof and application thereof
A cry52ba1, bt protein technology, applied in the new Bt protein and its coding gene and application field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1c
[0025] Cloning of embodiment 1cry52Bal gene
[0026] The present invention is isolated from the new strain of Bacillus thuringiensis (Bacillus thuringiensis) obtained from the soil in the virgin forest area of Muchuan, Sichuan Province. No. 3, Datun Road, Chaoyang District, City, Institute of Microbiology, Chinese Academy of Sciences, zip code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2871.
[0027] In this example, the full-length sequence of the cry52Bal gene was cloned by the following method.
[0028] Total DNA of BM59-2. The primer sequences were designed as follows:
[0029] P1: 5'ATGAATTCATATCAAAATAAAAAATG3'
[0030] P2: 5'TTACCTCCTACTTCAGTACATACTTT3'
[0031] PCR reaction system:
[0032] 10×buffer 2.5μl
[0033] MgCl 2(25mM) 1.5μl
[0034] Taq enzyme 0.2μl
[0035] dNTPs (2.5mM) 2μl
[0036] Primer 2μl
[0037] Template 5μl
[0038] Final reaction volume ...
Embodiment 2
[0040] Example 2 Expression of cry52Bal gene and determination of insecticidal activity
[0041] According to the sequence at both ends of the open reading frame of the cry52Bal gene, a pair of specific primers cry53F: 5′-GCG was designed and synthesized CATATG (NdeI)ATGAATTCATATCAAAATAAAAATG-3, cry53R: 5'-CG GAATTC (EcoR I) TTACCTCCTACTTCAGTACATACTTT-3', respectively at the 5' end primers Nde I and EcoR I restriction sites. The BM59-2 plasmid was used as a template to amplify, and the amplified product was double-digested with Nde I and EcoR I, and the digested product was ligated with the vector pET-30a(+) after the same double-digestion, and transformed into E.coli After DH5α competent cells were extracted and its plasmid was digested and electrophoresis verified that the size of the inserted fragment met the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named pET-52Ba, and the recombinant c...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com