Lytic enzyme inhibitor, lysis inhibitor, inhibitor of degradation of poly-gamma-glutamic acid, and method for production of poly-gamma-glutamic acid
A technology of degradation inhibitors and dissolution inhibitors, applied in chemical instruments and methods, dissolution of microorganisms, inactivation of enzymes by chemical treatment, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] [Example 1] Investigation of YoeB protein-lytic enzyme interaction
[0082] In this example, the interaction between the YoeB protein (SEQ ID NO: 2) encoded by the YoeB (SEQ ID NO: 1) gene and the CwlE protein encoded by the CwlE gene (SEQ ID NO: 3) was examined.
[0083] Specifically, the WE1YoeB3FL strain induced by IPTG to express the YoeB-3×FLAG protein and the WE1E3FL strain induced by IPTG to express the Cw1E-3×FLAG protein were firstly constructed. WE1YoeB3FL strain and WE1E3FL strain were prepared using WE1 strain (Yamamoto, H. et al., 2003 "Localization of the vegetative cell wallhydrases LytC, LytE, LytF on the Bacillus subtilis cell surface and stability of these enzymes to cell wall-bound or extracellular proteases (nutrient Localization of the cell wall hydrolytic enzymes LytC, LytE, LytF on the cell surface of Bacillus subtilis and the stability of these enzymes to cell wall-bound or extracellular proteases)" J. Becteriol., 185: 6666-6677). The WE1 strain...
Embodiment 2
[0102] [Example 2] Effect of YoeB protein on inhibiting lytic enzyme activity 1
[0103] In this example, the mode of action of the YoeB protein on the cell wall lytic activity of the lytic enzyme was investigated by an activity assay in liquid. In this example, the cell wall lytic activity of the C-terminal active domain (CwlECTD) of CwlE was measured in the presence or absence of YoeB protein using the cell wall component prepared in the same manner as in Example 1 as a substrate.
[0104] In this example, cell wall lytic activity was determined using 20 mM MES buffer (pH 6.5). Wash with assay buffer and OD 540 =0.6 corresponding to the amount of cell wall components, and the cell walls were pelleted by centrifugation. Remove the supernatant, add 2 ml of assay buffer to the pellet to prepare a suspension, prepare the cell wall fraction, and divide the final OD 540 The value was adjusted to 0.3, and the resultant was designated as the substrate solution.
[0105] Activity...
Embodiment 3
[0108] [Example 3] Effect of YoeB protein on inhibiting lytic enzyme activity 2
[0109] In this example, the cell wall lytic activity of the C-terminal active domains of Cw1S, Cw1O and YddH was determined using the cell wall components prepared in the same manner as in Example 1 as substrates in the presence or absence of YoeB protein.
[0110]
[0111] Using BF-YOJL primers (gcgc ggatcc tcaaacattcaaataggttcg: SEQ ID NO: 60) and KR-YOJL primer (gcgc ggtacc ggtcaatcattgtctggta: SEQ ID NO: 61), and using the genomic DNA extracted from the Bacillus subtilis 168 strain as a template, through PCR amplification with the D, L-endopeptidase domain (including the region from nucleotide 290 to the stop codon 3'-terminal DNA sequence of the CwlS gene corresponding to a 61-bp transcription terminator-like sequence). The underlined nucleotide sequences of the above BF-YOJL and KR-YOJL primers represent the BamHI and KpnI restriction endonuclease recognition sequences, respectively. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More