Check patentability & draft patents in minutes with Patsnap Eureka AI!

Moloney murine leukemia virus reverse transcriptase mutant as well as expression method and application thereof

A technology of murine leukemia virus and reverse transcriptase, which is applied in the field of genetic engineering and can solve problems such as the difficulty of enzyme transformation

Active Publication Date: 2009-12-30
GUANGZHOU HUAYIN MEDICINE SCI & TECH +1
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The currently available crystal structures of MMLV reverse transcriptase include the crystal structure of the full-length reverse transcriptase containing DNA in the non-catalytic state and the N-terminal crystal structure of the reverse transcriptase without DNA in the catalytic state, so in the structure- and mechanism-based enzyme Difficulty in reforming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Moloney murine leukemia virus reverse transcriptase mutant as well as expression method and application thereof
  • Moloney murine leukemia virus reverse transcriptase mutant as well as expression method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Construction and structural analysis of the MMLV reverse transcriptase structural model containing template-primers and dNTPs in the active state

[0020] Construction of structural models with templates / primers and dNTPs: Currently available crystal structures of MMLV include the full-length crystal structure of MMLV containing DNA far away from the catalytic site, and the N-terminal structure of MMLV reverse transcriptase without DNA in the catalytic state Crystal structure, so there are certain difficulties in the structure-based functional engineering of enzymes. There are many studies on the structure of HIV-1 reverse transcriptase, and the crystal structure of the template / primer and dNTP triple complex in the catalytic state has been obtained. The structures of MMLV reverse transcriptase and HIV-1 reverse transcriptase are highly homologous. We combined the crystal structure of HIV-1 reverse transcriptase triple complex (including enzyme, template-prim...

Embodiment 2

[0021] Example 2: Site-directed mutation of the 196-position proline (P) of MMLV reverse transcriptase is alanine (A)

[0022] Site-directed mutation of proline (P) at position 196 of MMLV reverse transcriptase (Genebank: AF033811) to alanine (A). The method of fusion PCR was used. First design the upstream and downstream primers RTUp and RTDown of the MMLV reverse transcriptase gene:

[0023] RTUp: 5'ATGCATATGACATGGCTGTCTGATTTT 3'

[0024] RTDown: 5'ATTACTCGAGTTAGAGGAGGGTAGAGGTGTCTGGAGTC 3'

[0025] And design primers 196Up and 196Down at the mutation site:

[0026] 196Up 5’CCA CAG GGT TTC AAA AAC AGT GCC ACC CTG TTT 3’

[0027] 196Down 5’AAA CAG GGT GGC ACT GTT TTT GAA ACC CTG TGG 3’

[0028] RTUp and 196Down were used as primers and the MMLV reverse transcriptase gene fragment was used as a template to amplify the N-terminal DNA fragment. Then use RTDown and 196Up as primers to amplify the C-terminal DNA fragment. The N-terminal and C-terminal DNA fragments amplified...

Embodiment 3

[0029] Embodiment 3: Expression and purification of MMLV reverse transcriptase mutant

[0030] Cloning: The MMLV mutant reverse transcriptase gene (P196A) was purified and then digested with Nde I / Xho I and cloned into the pET-28a vector, so that the His tag was added to the MMLV reverse transcriptase gene to produce pET-28a-RTP196A expression plasmid. The recombinant expression plasmid was confirmed to be correct by sequencing. Expression: The recombinant expression plasmid was transformed into E.coli BL21. Pick a single colony and culture it at 37°C until the OD600 value is 0.6, induce with 0.2mM IPTG for 3 hours, centrifuge at 4200rpm for 35 minutes, collect the bacterial liquid, and store it at -80°C. Purification: Buffer I (50mM NaH 2 PO 4 (pH 7.8), 5% glycerol, 0.3M NaCl) to suspend the bacterial liquid, add lysozyme to a final concentration of 1 mg / ml, and incubate on ice for 30 minutes to lyse. The lysed bacteria solution was centrifuged at 35,000 rpm for 40 minut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a moloney murine leukemia virus reverse transcriptase mutant as well as an expression method and application thereof. The mutant is a protein formed by substituting a praline residue at the 196th site of the moloney murine leukemia virus reverse transcriptase from the N end by an alanine residue. The expression method of the moloney murine leukemia virus reverse transcriptase comprises the steps of transforming an expression vector containing the coding gene of the moloney murine leukemia virus reverse transcriptase into Escherichia coli, culturing positive clones and expressing to obtain the moloney murine leukemia virus reverse transcriptase mutant. The mutant can be applied to RNA synthesis, and the reverse transcriptase mutant obtained from reconstructing the moloney murine leukemia virus reverse transcriptase has a fidelity function.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the Moloney murine leukemia virus reverse transcriptase mutant and its expression method and application. Background technique [0002] Reverse transcription is a process in which viral RNA is synthesized into DNA under the catalysis of reverse transcriptase and integrated into the host cell genome when retroviral genomic RNA is replicated. Reverse transcriptase is an enzyme unique to this type of virus. It performs the following functions: ① DNA polymerization dependent on RNA or DNA as a template; ② strand conversion; ③ RNase H function to degrade RNA in RNA-DNA hybrids. Therefore, reverse transcriptase is often used in the construction of cDNA library. The transformation of Moloney Murine Leukemia Virus (MMLV) reverse transcriptase on the market is mainly aimed at the RNaseH part of the enzyme to achieve the function of weakening the degradation of RNA in DNA-RNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/70C12N15/63C12N1/00C12P19/34C12R1/93C12R1/19
Inventor 张芃伟彭涛周荣
Owner GUANGZHOU HUAYIN MEDICINE SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More