ELISA kit for detecting porcine circovirus antibody II
A porcine circovirus, type 2 antibody technology, applied in biological testing, measuring devices, material inspection products, etc., can solve problems such as high background and false positives, and achieve short detection time, near-sensitivity, and simple operation process. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] Preparation of coating antigen:
[0027] According to the gene sequence of PCV2 in GenBank (Accession No.: AY943819), two primers were designed, and the above primers were: GC GAATTC ATGGGCATCTTCAACACCCGCCTCTC; downstream primer is: GC GTC GACTTACTTAGGGTTAAGTGGGGGGTC. Amplify the Cap gene without nuclear localization signal from the porcine PCV2 genome by PCR, clone it into the pET32-a(+) prokaryotic expression vector (purchased from Novagen, product number: 69015-3), and construct pET32a -Cap recombinant expression vector. Transformed into Escherichia coli BL21(DE3), and expressed the recombinant Cap fusion protein with reference to Novagen's pET Syetem Manual, and the protein was expressed in a soluble manner. Purify the expressed fusion protein with affinity chromatography (Novagen His-BindKit, product number: 70239-3), see figure 1 .
[0028] Preparation of PCV2 antibody detection plate:
[0029] Dilute the purified Cap fusion protein with 0.05M carbonate bu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap