Trichoderma reesei alpha-amylase is a maltogenic enzyme

A technology of Trichoderma reesei and amylase, applied in the directions of enzymes, biochemical equipment and methods, enzymes, etc., can solve the problems such as the difficulty in achieving glucose concentration

Inactive Publication Date: 2010-01-27
DANISCO US INC
View PDF33 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These high glucose concentrations are not easily achieved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma reesei alpha-amylase is a maltogenic enzyme
  • Trichoderma reesei alpha-amylase is a maltogenic enzyme
  • Trichoderma reesei alpha-amylase is a maltogenic enzyme

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0164] 4.1. Preparation of starch substrate

[0165] Those of ordinary skill in the art will be well aware of available methods that can be used to prepare starch substrates for use in the methods disclosed herein. For example, useful starch substrates may be obtained from tubers, roots, stems, legumes, cereals or whole grains. More specifically, granular starch may be obtained from corn, ear of corn, wheat, barley, rye, millet, sago, cassava, tapioca, sorghum, rice, pea, bean, banana or potato . Corn contains about 60-68% starch; barley contains about 55-65% starch; millet contains about 75-80% starch; wheat contains about 60-65% starch; and polished rice contains 70-72% starch. Particularly contemplated starch substrates are corn starch and wheat starch. Starch from the grain may be ground or whole, and includes corn solids such as kernels, bran, and / or ears of corn. The starch may be highly refined raw starch or raw material from a starch refining process. A variety of...

Embodiment 1

[0225] 1.1 Cloning of TrAA gene

[0226] Using BIO101 Fast System, according to the method described by the supplier (Qbiogene, Inc., Irvine, CA), from potato dextrose broth (Difco TM Chromosomal DNA of Trichoderma reesei QM6a was isolated from mycelial pellets of liquid cultures in Cat. No. 254920). The DNA was purified using Quick spin columns (Qiagen, Inc., Valencia, CA; cat. no. 28106). Using primers with TrAA-specific sequences designed according to the predicted nucleotide sequence in the Trichoderma reesei genome database of the U.S. Department of Energy Joint Genome Research Institute, forward primer NSP331 (SEQ ID NO: 6: ATGAAGCTCCGGTACGCTCTCC) and reverse primer NSP332 (SEQ ID NO: 7: TCACGAAGACAGCAAGACAATGGGC) Isolated TrAA gene. The primers are flanked at the 5' end by attB sequence (Invitrogen Corp., Carlsbad, CA). Trichoderma reesei QM6a chromosomal DNA was used as template.

[0227] PCR mix contains the following components: 4 μL forward primer (10 μM); 4...

Embodiment 2

[0241] TrAA is used to increase the yield of glucose in saccharification reactions catalyzed by glucoamylases at low pH. TrAA (Lot No. GCI2004017 / 018-UF) was purified as described in Example 1, Section 1.3. Glucoamylase was from GA-L, Lot No. 901-04290-001 (Genencor International, Inc.), with an activity of 385 GAU / g. The substrate consisted of a liquefied starch substrate prepared as follows: 745 g of raw cornstarch was diluted with water to give a slurry of 32% w / w ds. Addition of thermostable bacterial alpha-amylase Ethyl (Genencor International, Inc.) Lot No. 107-04107-001 to a concentration of 0.3 kg / mt ds, and the solution was liquefied at 92°C for 25 minutes. Using methods well known in the art, an iodine test was performed to measure residual starch concentration.

[0242] The liquefied starch was cooled to 60°C and the pH was adjusted to 4.2 with 20% v / v sulfuric acid. Add TrAA and 4060, and the reaction was carried out at 60°C for 30 hours. At the conclusion ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

A maltogenic alpha-amylase from Trichoderma reesei (TrAA) and variants thereof are useful in the production of high-maltose syrups from liquefied starch. Particularly high maltose concentrations are achieved when TrAA is used in the presence of a pullulanase. Expression hosts and encoding nucleic acids useful for producing TrAA and its variants also are provided.

Description

[0001] This application claims priority to U.S. Provisional Application 60 / 906,811, filed March 14, 2007, and U.S. Provisional Application 60 / 906,812, filed March 14, 2007, each of which is incorporated herein by reference in its entirety . [0002] sequence listing [0003] Also attached is a Sequence Listing comprising SEQ ID NO: 1-7, which is hereby incorporated by reference in its entirety. field of invention [0004] Maltogenic alpha-amylase (TrAA) from Trichoderma reesei, nucleic acids encoding such enzymes and host cells comprising said nucleic acids are provided. The method of using TrAA involves saccharifying starch into a maltose-rich syrup. Background of the invention [0005] High fructose corn syrup (HFCS) is a processed form of corn syrup with a high fructose content and a sweetness comparable to sugar, thereby enabling the utilization of HFCS as a sugar substitute in soft drinks and other processed foods. HFCS currently represents a billion dollar industry....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/30A23L7/104A23L35/00
CPCC12N9/242
InventorG·段K·钱M·谢弗斯J·舍蒂P·范索林格恩
OwnerDANISCO US INC