Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, vector containing same and application thereof
A ligase and carrier technology, applied in DNA/RNA fragments, applications, gene therapy, etc., can solve the problems of high price of interfering RNA, short duration of action, poor interference effect, etc., to prevent and treat muscle atrophy, enhance, Long-lasting effect and good targeting effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Embodiment 1, design of interfering RNA sequence targeting Atrogin-1 gene, vector construction and cell Pharmacodynamic testing at cellular and animal levels.
[0064] 1. Sequence design of interfering RNA inhibiting Atrogin-1 gene expression and construction of expression vector
[0065] 1. Design of interference RNA sequence
[0066] (1), design of the interfering RNA sequence targeting the 3' end of the Atrogin-1 gene
[0067] Using interference sequence design software ( siRNA design ) to design the interfering RNA sequence targeted at the 3' end of the Atrogin-1 gene (SEQ ID NO: 7): the designed DNA sequence corresponding to the interfering RNA is as follows figure 1 B, The interfering sequences are all homologous to human and mouse, and can form a small hairpin structure after transcription, so that they can be successfully recognized and cut by dicer enzyme, and lead to the degradation of mRNA. Taking the sequence of Atrogin-3'-1 as an example, its ...
Embodiment 2
[0116] Example 2, Design of Interfering Sequence Targeting MuRF 1 Gene, Vector Construction and Cell and Animal Methods Ping pharmacodynamic testing.
[0117] 1. Construction of an interfering RNA gene expression vector that inhibits MuRF 1 gene expression
[0118] 1. Design of interference RNA sequence
[0119] (1), design of the interfering RNA sequence targeting the 3' end of the MuRF 1 gene
[0120] Use the interference sequence design software to design the RNA interference sequence targeting the 3' end of the MuRF1 gene (SEQ ID NO: 8), the DNA sequence of which is as follows:
[0121] M-3’-1 5’TCGAAAAAAGGACAGATGAGGAGGAGGATCAACAG
[0122] TCCTCCTCCTCATCTGTCCTTTTT3' (SEQ ID NO: 4)
[0123] In the following description, M-3'-1 siRNA is referred to as siRNA for short in Example 2
[0124] (2) Design of interfering RNA sequence targeting the 5' end of MuRF 1 gene
[0125] Method is with embodiment 1.
[0126] M-5'-1:
[0127] 5'GATCAAAAATGGAGAACCTGGAGAAGCAT...
Embodiment 3
[0159] Example 3: Construction of a combined vector targeting Atrogin-1 and MuRF 1, at the cellular level and in animals Level pharmacodynamic testing.
[0160] 1. Construction of bivalent interfering RNA carrier
[0161] The above-mentioned interference fragment expression cassettes (H1+siRNA+U6) targeting the 3' end, 5' end and the middle region of the Atrogin-1 gene and the MuRF 1 gene that have been proven to be effective were respectively extracted from the recombinant vector PDC312+H1+siRNA+U6 Excised (taking A-3'-1 (SEQ ID NO: 1) and M-3'-1 (SEQ ID NO: 4) as examples), the expression cassettes were filled with Klenow fragments, respectively, and synthesized The enzyme-cut linkers XbaI, SalI, EcoRI, and BamHI were connected, and connected to the corresponding sites of the adenovirus PDC312 vector. Sent for sequencing, the adenovirus vector A-3'-1+M-3'-1 was successfully constructed.
[0162] 2. Pharmacodynamic detection of interfering RNA
[0163] (1) Pharma...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com