Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of EV71 virus antibody

An antibody and virus technology, applied in the field of EV71 virus antibody preparation, can solve the problems of fast transmission speed, many transmission routes, and difficulty in preventing and controlling the disease, and achieves the effect of fast preparation speed and cost reduction.

Inactive Publication Date: 2010-10-20
珠海市英平生物科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there is no vaccine against the disease. The main treatment is prevention, combined with drug treatment. However, due to the fact that there are many hidden infections in the disease, and the transmission speed is fast and there are many transmission routes, it is very difficult to prevent and control the disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of EV71 virus antibody
  • Preparation method of EV71 virus antibody
  • Preparation method of EV71 virus antibody

Examples

Experimental program
Comparison scheme
Effect test

preparation Embodiment 1

[0028] 1) Use the upstream primer: CCCGAATTCGGAGATAGGGTGGCAGAT (SEQ ID NO:

[0029] 5), downstream primer: CCCCTCGAGGAGAGTGGTGATCGCTGC (SEQ ID NO:

[0030] 6), using TouchDown-PCR to amplify a fragment consistent with the 2439bp-3329bp (SEQ ID NO: 2) of the EV71 virus strain SHZH98 gene sequence, the fragment size is 891bp, among the upstream primers, GAATTC is the restriction site of EcoRI, and the downstream primer Among them, CTCGAG is the XhoI restriction site;

[0031] 2) Use EcoRI and XhoI to clone the PCR product into the pGEX-4T1 vector to construct a recombinant plasmid. After sequencing and confirmation, transfer the recombinant plasmid into bacteria BL21, shake the bacteria at 37°C and 250rpm to OD 600 After 0.6-0.8, IPTG was added to induce expression for two hours.

[0032] 3) The expressed recombinant protein exists in the form of inclusion bodies in bacteria, and the cells are collected by centrifugation at 12000rpm, and the lysate (100mM NaH 2 PO 4 , 10mM T...

preparation Embodiment 2

[0035] 1) Using the upstream primer: AAAGAATTCGGTTTTCCCACTGAA (SEQ ID NO: 7), the downstream primer: CCCCTCGAGGAGAGTGGTGATCGCTG (SEQ ID NO: 8), using TouchDown-PCR to amplify the 1713bp-3329bp (SEQ ID NO: 3 ) a consistent fragment with a fragment size of 1617bp. In the upstream primer, GAATTC is the restriction site of EcoRI, and in the downstream primer, CTCGAG is the restriction site of XhoI;

[0036] 2) Use EcoRI and XhoI to clone the PCR product into the pGEX-4T1 vector to construct a recombinant plasmid. After sequencing and confirmation, transfer the recombinant plasmid into Escherichia coli Rosetta and shake the bacteria to OD at 37°C and 250rpm 600 Add IPTG after 0.6-0.8 to induce expression for three hours.

[0037] 3) The expressed recombinant protein exists in the form of inclusion bodies in bacteria, and the cells are collected by centrifugation at 12000rpm, and the lysate (100mM NaH 2 PO 4 , 10mM Tris-HCl, 8M urea, pH8.0) after resuspended, ultrasonically crushe...

preparation Embodiment 3

[0040] 1) Using the upstream primer: AAAGAATTCGGAGATAGGGTGGCAGATGT (SEQ ID NO: 9), the downstream primer: CCCCTCGAGCTGCTCCATAGCTTTCTTCATC (SEQ ID NO: 10), using TouchDown-PCR to amplify the 2439bp-3779bp (SEQ ID NO: 4) consistent with the EV71 virus strain SHZH98 gene sequence fragment, the fragment size is 1341bp, in the upstream primer, GAATTC is the restriction site of EcoRI, in the downstream primer, CTCGAG is the restriction site of XhoI;

[0041] 2) Use EcoRI and XhoI to clone the PCR product into the pGEX-4T1 vector to construct a recombinant plasmid. After sequencing and confirmation, transfer the recombinant plasmid into Escherichia coli Rosetta and shake the bacteria to OD at 37°C and 250rpm 600 After 0.6-0.8, IPTG was added to induce expression for two hours.

[0042] 3) The expressed recombinant protein exists in the form of inclusion bodies in bacteria, and the cells are collected by centrifugation at 12000rpm, and the lysate (100mM NaH 2 PO 4 , 10mM Tris-HCl, 8M ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an EV71 virus antibody, which comprises following steps of: designing an upstream primer and a downstream primer with different restriction enzyme cutting sites, and amplifying an antigen determining sequence of the EV71 virus strain SHZH98; cloning the antigen determining sequence which is obtained on a carrier in an amplify way, and building a recombinant plasmid; transferring the recombinant plasmid into germ or fungus to be expressed, and collecting antigen protein which is obtained in an expression way; and dissolving the antigen protein, injecting the antigen protein into animal body, inducing the animal to produce antibody, collecting and purifying to obtain the virus antibody. The virus antibody can prevent users from being infected with the EV71 virus, has the function for preventing and curing the hand-foot-and-mouth disease, and can be directly added into foods and health care products.

Description

technical field [0001] The invention relates to a preparation method of virus antibody, in particular to a preparation method of EV71 virus antibody. Background technique [0002] Hand, foot and mouth disease, English name: Hand-foot-and-mouth disease, is an infectious disease caused by enterovirus, mostly occurs in children under 5 years old, can cause herpes on hands, feet, mouth and other parts, a small number of children Can cause myocarditis, pulmonary edema, aseptic meningoencephalitis and other complications. Individual children with severe illness may die if their condition develops rapidly. [0003] There are more than 20 types (types) of enteroviruses that cause hand, foot and mouth disease. Coxsackievirus types 16, 4, 5, 9, and 10 of group A, types 2 and 5 of group B, and enterovirus type 71 are all Among the more common pathogens of HFMD, Coxsackievirus A16 (CoxA16) and enterovirus 71 (EV71) are the most common. [0004] Hand, foot and mouth disease is a globa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C12N15/40C12N15/63C07K14/08
Inventor 支旭勃刘磊郭海荣王俊
Owner 珠海市英平生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com