Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof

A promoter and gene technology, which is applied to seedling and seed-specific expression soybean GmPLPA gene promoter and its application field, can solve the problems of waste of material and energy, change of plant shape, influence on plant growth and development, etc., and achieves high efficiency and specificity. The effect of strong performance and avoiding waste of resources

Inactive Publication Date: 2010-12-15
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It not only increases the metabolic burden of plants, but also causes a huge waste of material and energy, often causes changes in plant morphology, and even affects plant growth and development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof
  • Seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof
  • Seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the acquisition of promoter

[0034] 1. Acquisition of the promoter

[0035] According to Clontech's GenomeWalker TM Universal Kit carried out.

[0036] 1. Genomic DNA extraction from soybean leaves by CTAB method

[0037] Take 1g of fresh leaves of soybean variety Dongnong L13, quickly grind them into powder under liquid nitrogen freezing, then put the powder into a 50ml centrifuge tube, add 15ml of extraction buffer, mix well, and put it in a water bath at 65°C for 2h, during which every 15min Gently invert and mix; add an equal volume of CI (CI: chloroform: isoamyl alcohol = 24:1), invert and mix, 3000rpm / 15min, extract the supernatant; repeat once; add 50μl RNA digestion enzyme, digest at room temperature for 30min; add Equal volume of pre-cooled isopropanol, mix well, and place at -20°C for 1 hour; pick out DNA with a toothpick and put it in a 1.5ml centrifuge tube; add 1ml of 70% ethanol, centrifuge at 1000rpm for 1min, wash twice; wxya 2 O was...

Embodiment 2

[0066] Example 2, functional verification of the promoter

[0067] 1. Design primers

[0068] Primers were designed according to the pGmPLPA (promoter) shown in Sequence 1, and BamH I and HindIII restriction sites were introduced at both ends of the 5' and 3' respectively; the primers were as follows (5'→3'):

[0069] pGmPLPA sense primer: GGCAAGCTTTGGTATCGTAATCGGCA;

[0070] pGmPLPA antisense primer: CGGGGATCCCGTTGTTGGTGTTGTTG.

[0071] Two, the preparation of pGmPLPA (promoter)

[0072] 1. Extract Dongnong L13 (Northeast Agricultural University guarantees to provide to the public; Reference: Lin Zhao and WenbinLi*(2008) A RAV-like transcription factor control photosyntheses and senescence in soybean.Planta.227:1389-1399) leaves Genomic DNA.

[0073] 2. PCR amplification

[0074] Add the following PCR reaction components in order:

[0075] Soybean genome (0.1μg / μl) 1μL

[0076] 10×PCR buffer 5μL

[0077] dNTP Mix (10mM) 1μL

[0078] GmPLPA sense primer 1 μL

[0079]...

Embodiment 3、5

[0126] Example 3, 5' end deletion method to study the relationship between the structure and function of the pGmPLPA promoter

[0127] 1. Preparation of each DNA fragment

[0128] Using the same downstream primer and different upstream primers, a series of deletions were performed on the promoter shown in Sequence 1 to prepare DNA fragments of different lengths. In the upstream primers, a HindIII site was introduced. The downstream primers of each DNA fragment are pGmPLPA antisense primers (5'→3'): CGGGGATCCCGTTGTTGGTGTTGTTG. The size of each DNA fragment and its upstream primer (5'→3') are as follows:

[0129] DNA fragment ①: 1214bp, which is the DNA shown in the 284th to 1497th nucleotides from the 5' end of Sequence 1 in the sequence listing; upstream primer: GGCAAGCTTGATACCATGATAAATC;

[0130] DNA fragment ②: 1139bp, which is the DNA shown in the 359th to 1497th nucleotides from the 5' end of Sequence 1 in the sequence listing; upstream primer: GGCAAGCTTGCAAGGTAAAACTCAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof. The promoter provided by the invention is a deoxyribonucleic acid (DNA) molecule shown as a sequence 1 or partial segment of the molecule. The GmPLPA gene promoter is cloned in the soybean for the first time. The promoter of the invention can be applied at a specific stage (such as a seedling stage) of plant development or to a specific texture (such as seed) expression target gene to avoid resource waste caused by the starting of the target gene by a constitutive promoterand has the advantages of high specificity and high efficiency. The promoter provided by the invention can be applied to a new transgenic plant variety with high directive breeding safety and has great value for plant breeding and the research on the function and acting mechanism of the target gene.

Description

technical field [0001] The invention relates to a seedling and seed specific expression type soybean GmPLPA gene promoter (pGmPLPA) and application thereof. Background technique [0002] The regulation of eukaryotic gene expression is controlled by cis-acting elements of gene regulation on the one hand, and by a series of trans-acting factors on the other hand, that is, protein factors with regulatory functions. The cis-acting elements that act on eukaryotic gene expression consist of promoters and regulatory sequences. Promoter is a DNA sequence that can be recognized and bound by RNA polymerase, which can activate RNA polymerase, guide the combination of holoenzyme and template, and determine the specific form and frequency of transcription initiation. Most promoters are located upstream of the 5' end of the gene. [0003] Promoters can be divided into five categories according to their transcription patterns: constitutive promoters, tissue or organ-specific promoters, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A01H5/00
Inventor 李文滨罗秋兰赵琳韩英鹏
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com