Seedling and seed specific expression GmPLPA gene promoter for soybean and application thereof
A promoter and gene technology, which is applied to seedling and seed-specific expression soybean GmPLPA gene promoter and its application field, can solve the problems of waste of material and energy, change of plant shape, influence on plant growth and development, etc., and achieves high efficiency and specificity. The effect of strong performance and avoiding waste of resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, the acquisition of promoter
[0034] 1. Acquisition of the promoter
[0035] According to Clontech's GenomeWalker TM Universal Kit carried out.
[0036] 1. Genomic DNA extraction from soybean leaves by CTAB method
[0037] Take 1g of fresh leaves of soybean variety Dongnong L13, quickly grind them into powder under liquid nitrogen freezing, then put the powder into a 50ml centrifuge tube, add 15ml of extraction buffer, mix well, and put it in a water bath at 65°C for 2h, during which every 15min Gently invert and mix; add an equal volume of CI (CI: chloroform: isoamyl alcohol = 24:1), invert and mix, 3000rpm / 15min, extract the supernatant; repeat once; add 50μl RNA digestion enzyme, digest at room temperature for 30min; add Equal volume of pre-cooled isopropanol, mix well, and place at -20°C for 1 hour; pick out DNA with a toothpick and put it in a 1.5ml centrifuge tube; add 1ml of 70% ethanol, centrifuge at 1000rpm for 1min, wash twice; wxya 2 O was...
Embodiment 2
[0066] Example 2, functional verification of the promoter
[0067] 1. Design primers
[0068] Primers were designed according to the pGmPLPA (promoter) shown in Sequence 1, and BamH I and HindIII restriction sites were introduced at both ends of the 5' and 3' respectively; the primers were as follows (5'→3'):
[0069] pGmPLPA sense primer: GGCAAGCTTTGGTATCGTAATCGGCA;
[0070] pGmPLPA antisense primer: CGGGGATCCCGTTGTTGGTGTTGTTG.
[0071] Two, the preparation of pGmPLPA (promoter)
[0072] 1. Extract Dongnong L13 (Northeast Agricultural University guarantees to provide to the public; Reference: Lin Zhao and WenbinLi*(2008) A RAV-like transcription factor control photosyntheses and senescence in soybean.Planta.227:1389-1399) leaves Genomic DNA.
[0073] 2. PCR amplification
[0074] Add the following PCR reaction components in order:
[0075] Soybean genome (0.1μg / μl) 1μL
[0076] 10×PCR buffer 5μL
[0077] dNTP Mix (10mM) 1μL
[0078] GmPLPA sense primer 1 μL
[0079]...
Embodiment 3、5
[0126] Example 3, 5' end deletion method to study the relationship between the structure and function of the pGmPLPA promoter
[0127] 1. Preparation of each DNA fragment
[0128] Using the same downstream primer and different upstream primers, a series of deletions were performed on the promoter shown in Sequence 1 to prepare DNA fragments of different lengths. In the upstream primers, a HindIII site was introduced. The downstream primers of each DNA fragment are pGmPLPA antisense primers (5'→3'): CGGGGATCCCGTTGTTGGTGTTGTTG. The size of each DNA fragment and its upstream primer (5'→3') are as follows:
[0129] DNA fragment ①: 1214bp, which is the DNA shown in the 284th to 1497th nucleotides from the 5' end of Sequence 1 in the sequence listing; upstream primer: GGCAAGCTTGATACCATGATAAATC;
[0130] DNA fragment ②: 1139bp, which is the DNA shown in the 359th to 1497th nucleotides from the 5' end of Sequence 1 in the sequence listing; upstream primer: GGCAAGCTTGCAAGGTAAAACTCAT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap