Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor marker

A tumor and conjugate technology, applied in the field of tumor treatment and tumor metastasis, can solve the problems of unidentified Hsp90α existence form, no mention of tumor metastasis correlation, no definition of normal and abnormal content ranges, etc.

Active Publication Date: 2013-08-14
TSINGHUA UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this article also did not identify the form of Hsp90α in the blood of tumor patients, nor did it mention its correlation with tumor metastasis; in addition, this article only studied non-small cell lung cancer, breast cancer, liver cancer, pancreas The correlation and specificity between cancer and plasma Hsp90α are not involved; and this article only qualitatively studies the changes of serum Hsp90α levels in tumor patients, the changes of its absolute content, and the normal and prognostic factors necessary for tumor diagnosis and prognosis. The abnormal content range is not defined

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor marker
  • Tumor marker
  • Tumor marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0112] Example 1: Collection and preparation of mouse plasma samples, and detection of plasma Hsp90α

[0113] Select Balb / c mice with an average body weight of about 20 grams (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.), and randomly divide them into two groups, with 3 mice in each group, and H22 mouse liver cancer cells were implanted in the axilla of one group (CCTCC, number: GDC091) 10 cells per access 6 A control group was not inoculated with tumors. When the diameter of the mouse tumor grew to an average of 2 cm (about 20 days), blood was collected from the fundus venous plexus, and an anticoagulant was added to the blood to avoid hemolysis. Samples were recollected if hemolyzed. After the whole blood was collected, it was centrifuged twice at 4°C and 6000g, and the supernatant was taken, and the content of Hsp90α in the plasma was detected by Western blotting. The antibody was Rabbit anti-human Hsp90αpAb (Labvasion). The BCA method (Pi...

Embodiment 2

[0114] Example 2: Collection and preparation of plasma samples from normal people and tumor patients, and detection of plasma Hsp90α

[0115] Take whole blood from normal people or cancer patients and send it to the laboratory within 24 hours under low temperature conditions (about 4°C). Hemolysis must be avoided. If the sample is hemolyzed, it must be collected again. Centrifuge twice at 4°C and 6000g, take the supernatant, and detect the content of Hsp90α in plasma by Western blotting. If it cannot be detected immediately, it will be aliquoted and stored at -80°C. The test results will be compared with the clinical diagnosis to verify the correlation between the Hsp90α content in plasma and the degree of tumor malignancy.

[0116] The specific operation method of Western blot detection is: the plasma sample is mixed with the loading buffer 1:1, and 1-2 microliters of the sample are loaded for SDS-PAGE. The primary antibody is a specific antibody that recognizes plasma Hsp90α...

Embodiment 3

[0117] Example 3: Preparation of Hsp90α-specific rabbit polyclonal antibody and mouse monoclonal antibody

[0118] Primers (synthesized from Invitrogen) and Pfu DNA polymerase consisting of the nucleotide sequences of Hsp90α-Sal1-Re: ACGCGTCGACTTAGTCTACTTCTTCCATGC (SEQ ID No. 8) and Hsp90α-Sph1-For: ACATGCATGCATGCCTGAGGAAACCCAGACC (SEQ ID No. 9) were used (Source: NEB) The full-length sequence of Hsp90α was amplified from a human liver cDNA library (source: Stratagene). Sph1 and Sal1 (source: NEB) were used to double-digest the fragment and the pQE80L vector (source: Qiagen). Fragments were ligated using T4 ligase (source: NEB). The ligation product was transformed into Top10 Escherichia coli competent cells (source: Transgen) for amplification and verification, and the verified plasmid was then transformed into BL21DE3 Escherichia coli competent cells (source: Transgen) for expression to obtain recombinant human Hsp90α protein. Purification method of recombinant human Hsp90α...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the diagnosis and treatment of cancer, and specifically to a method of diagnosing the presence or metastasis of cancer by detecting plasma Hsp90± having the amino acid sequence of SEQ ID No. 1 as a tumor marker. In addition, the present invention also relates to a method for the treatment of cancer and metastasis.

Description

technical field [0001] The present invention relates to the field of tumor diagnosis and treatment, and in particular to a new tumor marker, a method and a kit for diagnosing tumor occurrence and metastasis, and to a method and medicine for treating tumor and tumor metastasis. Background technique [0002] Currently, about 11 million people worldwide are diagnosed with cancer each year. And it is expected that there will be 16 million new cases every year before 2020. In 2005, among the 58 million total deaths worldwide, 7.6 million were caused by cancer (about 13% of the total deaths), and this number is still increasing year by year, and it is expected that by 2015 there will be Nine million people die from cancer, and that number will reach 11.4 million by 2030 (World Health Organization, 2006). [0003] Tumor markers are antigens and other biologically active substances produced or reduced by tumor cells due to changes in gene expression levels during the process of ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435G01N33/574G01N33/577A61K39/395A61K48/00A61P35/00
CPCG01N33/57423C07K16/18G01N2800/56C07K14/47A61K2039/505G01N2800/52C07K16/30A61P35/00A61P35/04C12Q1/6806
Inventor 罗永章宋晓敏王晓峰卓巍常国栋付彦
Owner TSINGHUA UNIV