Unlock instant, AI-driven research and patent intelligence for your innovation.

Process for the production of gamma-aminobutyric acid

A technology for aminobutyric acid and amino acids, which is applied in the field of producing γ-aminobutyric acid, and can solve problems such as unrecorded suitable methods

Inactive Publication Date: 2011-01-12
BASF AG
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Suitable methods for fermentative production of this commercially valuable compound have not been documented

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for the production of gamma-aminobutyric acid
  • Process for the production of gamma-aminobutyric acid
  • Process for the production of gamma-aminobutyric acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0046] 3.1 Dysregulation of other genes

[0047] Fermentative production of GABA using recombinant Corynebacterium glutamate producers expressing glutamate decarboxylase can be further improved if combined with dysregulation of at least one other gene as listed below.

[0048]

[0049] A preferred form of "amplified" is an "up" mutation that increases gene activity, for example gene amplification by using a strong expression signal and / or point mutations that increase enzymatic activity.

[0050] A preferred form of "attenuation" is a "down" mutation that reduces gene activity, eg gene deletion or dysregulation by using weak expression signals and / or point mutations that disrupt or reduce enzyme activity.

[0051] 3.2 Proteins of the invention

[0052] The invention is not limited to the specifically mentioned proteins, but also extends to functional equivalents thereof.

[0053] Within the scope of the present invention, "functional equivalents" or "analogues" or "functi...

Embodiment 1

[0209] Example 1: Cloning of the Escherichia coli glutamic acid decarboxylase (GAD) gene

[0210] PCR primers WKJ95 / WKJ96 and WKJ99 / WKJ100 were used to amplify the DNA fragments containing gadBC and gadA genes, respectively, using the chromosomal DNA of Escherichia coli as a template. The amplified DNA fragment was purified, digested with restriction enzymes XhoI / XbaI (for gadBC) and XhoI / SpeI (for gadA), and ligated into pClik5aMCS (SEQ ID NO: 14; image 3 ) vectors to obtain pClik5aMCSgadBC and pClik5aMCSgadA respectively.

[0211] Oligonucleotide primers used:

[0212] WKJ95 ccgctcgagcggcccaagcttcggtaaatacttataccggag (SEQ ID NO: 10)

[0213] WKJ96 ctagtctagactagcccaagcttgtcgatcatcgcctgttg (SEQ ID NO: 11)

[0214] WKJ99 ccgctcgagcggcccaagcttcgtgataaattgcgtcagaaag (SEQ ID NO: 12)

[0215] WKJ100 ctagactagtctagcccaagcttctcgaatttggcttgcatcc (SEQ ID NO: 13)

Embodiment 2

[0216] Example 2: Retrieval of the GAD gene in potato

[0217] To find the unknown gene encoding GAD in potato, the first step was to identify GAD in closely related organisms. A query for "glutamate decarboxylase" of Solanum in the sequence databases Genbank, Refseq and Uniprot revealed a previously characterized GAD in tomato, Swissprot accession number P54767. This sequence was used as a template for tblastn searches in Genbank plant subparts, EST and GSS. Among the 100 best hits (expected value -118 ), 16 sequences were from potato. All 16 sequences are expressed sequence tags (ESTs), ie fragments representing expressed and spliced ​​mRNA. Assembly using VectorNTI Contig Express (settings: overlap=20, identity=0.8, cutoff score=40) shows a contig consisting of 15 sequences, and a second contig consisting of 1 sequence ( BG594946).

[0218]To check the quality of the assembly and decide which contig to choose, the consensus sequence of the two assemblies was generated a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a novel method for the fermentative production of gamma-aminobutyric acid (GABA) by cultivating a recombinant micro-organism expressing an enzyme having a glutamate decarboxylase activity. The present invention also relates to corresponding recombinant hosts, recombinant vectors, expression cassettes and nucleic acids suitable for preparing such hosts as well as to a method for preparing polyamides making use of GABA as obtained fermentative production.

Description

[0001] The present invention relates to a novel method for fermentatively producing gamma-aminobutyric acid (GABA) by culturing recombinant microorganisms expressing an enzyme having glutamic acid decarboxylase activity. The present invention also relates to corresponding recombinant hosts, recombinant vectors, expression cassettes and nucleic acids suitable for preparing such hosts, and a method for preparing polyamide from GABA obtained by fermentation. Background technique [0002] GABA (CAS No. 56-12-2) is an important non-protein amino acid ubiquitous in prokaryotes and eukaryotes. It shows various biological functions, such as a representative inhibitory neurotransmitter in the sympathetic nervous system, and it is effective in lowering blood pressure in experimental animals and humans. This compound is synthesized from glutamate by glutamate decarboxylase (GAD; EC 4.1.1.15). [0003] GABA is used in different technical fields. For example, GABA-rich foods can be used ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/52C12P13/00
CPCC12P13/005C12N9/88C12P13/02C12Y401/01015C12N15/52C12N15/74C12P13/00C12R2001/15
Inventor O·策尔德尔W·K·郑C·克洛普罗格A·赫罗尔德H·施罗德
Owner BASF AG