Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof

A swine fever virus, small interference technology, applied in DNA/RNA fragments, antiviral agents, recombinant DNA technology, etc., can solve the problem of not completely preventing and controlling swine fever epidemics

Inactive Publication Date: 2011-08-17
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, passive immunization (injection of hyperimmune serum) and active immunization methods are generally used to prevent swine fever virus infection, but they still cannot completely prevent and control swine fever epidemics.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof
  • Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof
  • Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] The target sequence of embodiment 1 siRNA action:

[0102] 1. siRNA that can inhibit CSFV replication and infection

[0103] After using RNA interference technology to design and synthesize siRNA, these siRNA can specifically and efficiently inhibit the proliferation of CSFV and thus have a significant therapeutic effect on CSFV infection. The target sequence of siRNA action and its position in the CSFV genome are shown in Table 13:

[0104] targeting genes

[0105] *: Position relative to reference strain shimen, GenBank accession number: AF092448.

Embodiment 2

[0106] Example 2 Synthesis of siRNA in vitro:

[0107] According to the instructions of T7 RiboMAX Express RNAi System (Promega), design and synthesize the DNA sequence of the siRNA molecule and the T7 RNA polymerase binding sequence of the three fragments selected in Example 1, see the attached figure 1 ; respectively synthesize the template DNA for transcribing the sense strand and antisense strand of each siRNA molecule, the sequence is as follows:

[0108] T7 RNA polymerase binding sequence: 5'GGATCCTAATACGACTCACTATA 3'

[0109] NS3-1 sense strand template sequence:

[0110] 5'AATTGTATTCCACTCATAAGCTATAGTGAGTCGTATTAGGATCC 3'

[0111] NS3-1 antisense strand template sequence:

[0112] 5'AAGCTTATGAGTGGAATACAATATAGTGAGTCGTATTAGGATCC 3'

[0113] NS3-2 sense strand template sequence:

[0114] 5'AATAACTTAGGTTGTGGCATCTATAGTGAGTCGTATTAGGATCC 3'

[0115] NS3-2 antisense strand template sequence:

[0116] 5'AAGATGCCACAACCTAAGTTATATAGTGAGTCGTATTAGGATCC 3'

[0117] NS3-3 sense ...

Embodiment 3

[0130] Example 3 The design method of plasmid expression shRNA:

[0131] According to the design requirements of pSilencer3.1H1 Hygro (Ambion) shRNA vector, design the DNA sequence for expressing shRNA, and the restriction sites at both ends are Bam H I and Hind Ⅲ. The designed and synthesized primers are shown in Table 15.

[0132]

[0133] Specific steps are as follows:

[0134] Synthesize four plasmids producing shRNA molecules according to the following steps, dilute the synthesized single-stranded DNA to 100 μmol / L, and synthesize them into double-stranded DNA by PCR method: Take 25 μL of each diluted DNA and place in a PCR machine Denature at 95°C for 2 min, then at 56°C for 30 s. After the reaction, add 5.0 μL of 3 mol / L sodium acetate (pH 5.2), then add 2.5 times the volume of absolute ethanol, mix well, place at -20°C for 10 min, centrifuge at 12,000 r / min for 10 min, discard the upper For the supernatant, wash the precipitate with 1000 μL of 70% ethanol, disc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as an encoding sequence thereof. The invention also discloses a method for preparing an anti-CSFV infection biological preparation using an RNA-interfering method. The siRNA is efficient and can specifically inhibit CSFV. The method is applicable to industrial production. The invention also provides a biological preparation produced by using the method. The biological preparation has the CSFV inhibition ratio of 95.04-98.59%, and can distinctly inhibit CSFV infection in sensitive animals, so as to prevent incidence and death of animals.

Description

technical field [0001] The invention discloses a small interfering RNA and its coding sequence for inhibiting the replication and infection of the classical swine fever virus, and also discloses a method for preparing a biological agent for resisting the classical swine fever virus infection, relates to a drug for treating the classical swine fever virus infection, and belongs to the technical field of biopharmaceuticals. Background technique [0002] Classical swine fever virus (CSFV) is a highly contagious infectious disease caused by classical swine fever virus (CSFV). It is also one of the diseases that must be notified by OIE. The disease is widespread, has a high incidence, and is extremely harmful. CSFV is a member of the genus Pestivirus of the Flaviviridae family. It is an enveloped positive-strand RNA virus with a genome length of 12.3 kb. At present, passive immunization (injection of hyperimmune serum) and active immunization methods are generally used to prevent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11A61K48/00A61P31/14
Inventor涂长春李江南郭焕成
OwnerMILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI