Unlock instant, AI-driven research and patent intelligence for your innovation.

Loop-mediated isothermal amplification (LAMP) primer and kit for detecting super bacteria

A loop-mediated isothermal, amplification primer technology is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Sensitive and specific effects

Inactive Publication Date: 2013-06-05
吴兴海
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the existing detection methods, it is generally only through drug sensitivity tests to determine whether microorganisms are resistant to a certain antibiotic, which is time-consuming and cumbersome to operate, and cannot meet the needs of disease prevention and control; It is also required to be able to quickly and sensitively detect whether there are super bacteria in food and water sources, so as to prevent the harm of super bacteria to human body or farmed animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Loop-mediated isothermal amplification (LAMP) primer and kit for detecting super bacteria
  • Loop-mediated isothermal amplification (LAMP) primer and kit for detecting super bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Detection of artificially synthesized and constructed NDM1 plasmid DNA

[0052] Make the kit for NDM1 gene loop-mediated isothermal amplification reaction according to the following formula

[0053] 1) Ring-mediated isothermal amplification reaction solution A:

[0054] Each 25 μL contains 2.5 μL 10× Thermopol reaction buffer, 300-500 μmol dNTPs, 2-4 mmol MgSO 4 , 0.8-1.2 μmol upstream internal primer FIP, 0.8-1.2 μmol internal primer BIP, 0.2-0.3 μmol upstream external primer F3, 0.2-0.3 μmol downstream internal primer B3 and 1-1.5 M betaine;

[0055] The 10× Thermopol reaction buffer described therein contains 200mmol of Tris-HCl at pH8.8, 100mmol of KCl, 100mmol of NH 4 2SO 4 , 20mmol MgSO 4 and 1% Triton X-100;

[0056] The primer information described therein is as follows:

[0057] SEQ ID NO: 1 upstream inner primer:

[0058] GGCAGGTTGATCTCCTGCTTGATTTTTACCGCCTGGTCCGATG,

[0059] SEQ ID NO: 2 downstream inner primer:

[0060] CTGGCGGTGGTGACTCACG...

Embodiment 2

[0085] Embodiment 2: to the detection of the sample that does not contain NDM1 gene

[0086] 1) Ring-mediated isothermal amplification reaction solution A:

[0087] Each 25 μL contains 2.5 μL 10× Thermopol reaction buffer, 300-500 μmol dNTPs, 2-4 mmol MgSO 4 , 0.8-1.2 μmol upstream internal primer FIP, 0.8-1.2 μmol internal primer BIP, 0.2-0.3 μmol upstream external primer F3, 0.2-0.3 μmol downstream internal primer B3 and 1-1.5 M betaine;

[0088] The 10× Thermopol reaction buffer described therein contains 200mmol of Tris-HCl at pH8.8, 100mmol of KCl, 100mmol of NH 4 2SO 4 , 20mmol MgSO 4 and 1% Triton X-100;

[0089] The upstream internal primer, downstream internal primer, upstream external primer, and downstream external primer are the same as above

[0090] 2) UNG enzyme: 1U / μL;

[0091] 3) BstDNA polymerase B: 8mol / μL;

[0092] 4) Chromogen C: 10% fluorescent dye SYBR GREENI.

[0093] Follow the procedure (1) ~ (3) to operate:

[0094] (1) Extraction of DNA fro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a loop-mediated isothermal amplification (LAMP) primer and an LAMP kit for detecting New Delhi metallo-beta-lactamase 1 (NDM1) genes of super bacteria. In the primer, an upstream inner primer, a downstream inner primer, an upstream outer primer and a downstream outer primer have the sequences shown as SEQ ID No.1-4 respectively. In the invention, the LAMP primer is designed according to six sequences in basic reserved areas of the NDM1 genes, and the reserved gene sequences are shared by different bacterial strains with super drug resistance, so that the reliability of the NDM1 genes from different sources can be detected at a specific level. In the invention, an LAMP technology is adopted, has high specificity and has high sensitivity which is the same as that ofa polymerase chain reaction (PCR) detection method; expensive PCR instruments are not required, and only a common metal bath or water bath kettle is required; and a fluorescent dye is used for observing a result simply and quickly without the observation by a gel electrophoresis method. The primer and the kit can be used for detecting the NDM1 genes and are particularly suitable for primary medical institutions and farms.

Description

technical field [0001] The invention belongs to the technical field of disease detection reagents, and in particular relates to a loop-mediated isothermal amplification primer and a kit for detecting superbacteria NDM1 gene. Background technique [0002] There are a large number of natural drug resistance genes in nature. These genes are originally in the complex metabolic regulatory network of the original host, and play the role of signal transduction and gene regulation. However, when they enter a new host through horizontal gene transfer, because these drug-resistant genes are difficult to integrate into the metabolic network of the new host, their functions change, showing resistance to antibiotics. The abuse of antibiotics and environmental pollution by humans, like screening pressure, select and evolve these bacteria with integrated drug-resistant genes, making the latter eventually become superbugs. [0003] The NDM1 gene is the key pathogenic gene of superbugs. Und...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 吴兴海林黎明王英超
Owner 吴兴海