Plant-mediated insect RNA (Ribonucleic Acid) interference reinforced by using cysteine protease

A cysteine ​​protease and plant technology, applied in the direction of DNA / RNA fragments, plant products, plant genetic improvement, etc., can solve the problems of resurgence, decline in resistance of transgenic insect-resistant plants, etc.

Inactive Publication Date: 2011-09-21
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF10 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there have been research reports that as time goes by, the resistance of various transgenic insect-resistant plants is declining, and the phenomenon of large-scale and rare insect pests in the past has begun to resurface.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant-mediated insect RNA (Ribonucleic Acid) interference reinforced by using cysteine protease
  • Plant-mediated insect RNA (Ribonucleic Acid) interference reinforced by using cysteine protease
  • Plant-mediated insect RNA (Ribonucleic Acid) interference reinforced by using cysteine protease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The separation of embodiment 1 cotton cysteine ​​protease (GhCP) and Arabidopsis cysteine ​​protease (AtCP)

[0053] According to the sequence information of CAE54307, primers (FlGhCPF: ATGGAATTAACCCTTCTTTTC, FlGhCPR: GCAATGAATTCAAGCACTGC) were synthesized, and the gene GhCP encoding cotton cysteine ​​protease was amplified by PCR. Sequence alignment analysis was carried out between this sequence and the known cotton cysteine ​​protease CAE54307, and it was found that there were certain differences between GhCP and CAE54307 at the nucleotide and protein levels ( FIG. 1 ).

[0054] According to the sequence information of AT2G34080.1, primers (FlAtCPF: ATGGGTTATGCTAAATCAGC; FLAtCPR: TTAGGCAACCGAAACTTTATC) were synthesized, and the gene AtCP encoding the Arabidopsis cysteine ​​protease was amplified by PCR. After sequence identity analysis, it was found that AtCP was consistent with AT2G34080.1.

[0055] Amino acid sequence of GhCP (SEQ ID NO: 1):

[0056] MELTLLFPLFFTLS...

Embodiment 2

[0071] Example 2 Expressing GhCP and AtCP in E.coli

[0072] Before the start codon and stop codon of GhCP and AtCP, BamHI and SacI restriction sites were introduced respectively, and GhCP and AtCP were introduced into pET32a multiple cloning site between BamHI and SacI respectively ( figure 2 A), so as to obtain recombinant expression vectors respectively carrying corresponding target fragments, called pET32a / GhCP and pET32a / AtCP.

[0073] After transforming pET32a / GhCP and pET32a / AtCP into E.coli BL21(DE3), pick a single positive colony into 3mL LB (containing 100μg / mL Amp) medium, culture at 37°C, 220rpm until early logarithmic growth, add IPTG To a final concentration of 1 mM, continue to induce culture at 28°C for 2-3 hours. Take 1 mL of bacterial liquid and centrifuge at 12,000 g for 5 minutes, suspend the pellet in 100 μL of PBS, add an equal volume of 2×SDS loading buffer, mix and place in a boiling water bath for 5 minutes, centrifuge at 12,000 g for 10 minutes, tak...

Embodiment 3

[0075] Example 3 Cotton bollworm (Helicoverpa armigera) has increased permeability to gossypol after eating E.coli cells expressing GhCP or AtCP protein

[0076] Select the 3rd instar cotton bollworms with consistent growth and divide them into two groups, feed respectively the artificial diet mixed with the E.coli cells expressing Venus protein or GhCP (get 250ml OD as the bacterial liquid of 1.0, centrifuge, get the sediment, and 25g artificial diet (artificial For the formula and feeding method of the feed, see "Handbook of Insect Artificial Feed" such as Wang Yannian) mixed). After eating for two days, they were transferred to artificial feed containing 0.1% (mg / g) gossypol concentration, and continued to cultivate for one day. Stained with phloroglucinol to detect the content of gossypol in midgut cells, and found that the content of gossypol in midgut cells was significantly higher in larvae pretreated with E.coli cells expressing GhCP than in E.coli cells expressing Ven...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for reinforcing plant-mediated insect RNA (Ribonucleic Acid) interference by using cysteine protease. In the method, a construct for expressing an insect gene dsRNA (double-stranded Ribonucleic Acid) and a construct for expressing plant cysteine protease are transferred to a plant cell, tissue or organ, so that the plant cysteine protease and the insect gene dsRNA can be expressed in the plant cell, tissue or organ.

Description

technical field [0001] The present invention belongs to the fields of biotechnology and botany. In particular, the present invention relates to a method for enhancing plant-mediated RNA interference in insects using cysteine ​​proteases. Background technique [0002] In agriculture, insect pests have always been an important factor affecting crop yields. People have to invest a lot of manpower and material resources every year to suppress pests and increase crop yields. [0003] With the increasing resistance of agricultural pests to pesticides, and for the consideration of environmental protection and sustainable development, there is an urgent need for new pest-resistant methods. The emergence of transgenic insect-resistant plants has alleviated this contradiction and made a significant contribution to the development of agriculture, such as transgenic insect-resistant soybeans, Bt insect-resistant cotton, etc. However, studies have reported that as time goes by, the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N5/10A01H5/00A01H5/10A01H1/02
CPCC12N15/1137C12N15/8286C12N2310/14Y02A40/146
Inventor陈晓亚毛颖波薛学义林芝萍王凌健
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI