Enterovirus type 71 (EV71) infectious clone and construction method
An infectious cloning, enterovirus technology, applied in the direction of viruses/phages, microorganism-based methods, biochemical equipment and methods, etc. Efficient and stable, high success rate, low difficulty effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1. Obtaining of EV71 virus genome.
[0036] According to the molecular biology research on EV71 virus, referring to the relevant sequence published by GenBank (GenBank accession number: GU396280), after comparative analysis, three pairs of specific primers L1 upstream and downstream primers with modified amplification covering the whole genome were designed, L2 upstream and downstream primers and L3 upstream and downstream primers, these three specific primers are:
[0037] L1 upstream primer:
[0038]atagtc ttaatt aatgttaagcgtctgatgagtccgtgaggacgaaactataggaaaggaattcctatagtc
[0039] L1 downstream primer: gaag aagctt caagcacgtacgggtgttgcaactcgaag
[0040] L2 upstream primer: ttaag aagctt gcaggcggtacagggacggaagat
[0041] L2 downstream primer: tttgagatctgattc tctaga agtggcagctgt
[0042] L3 upstream primer: tcact tctaga gaatcagatctcaaatttggaacaat
[0043] L3 downstream primer: ttttctaga gcggccgc t 38 ;
[0044] In the above specific primers, a P...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com