Specific promoter of pathogenic filamentous fungi and use thereof

A technology of filamentous fungi and promoters, applied to fungi, using vectors to introduce foreign genetic material, microorganisms, etc., can solve the problem of gene regulation without reporting

Active Publication Date: 2013-01-30
CHONGQING UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been some reports on gene expression during appressorium formation of pathogenic fungi, but there is no report on gene regulation during appressoria formation and differentiation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific promoter of pathogenic filamentous fungi and use thereof
  • Specific promoter of pathogenic filamentous fungi and use thereof
  • Specific promoter of pathogenic filamentous fungi and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Isolation of promoters

[0023] The strain used in the present invention is Metarzhizium acridum strain CQMa102. Get the CQMa102 bacterial strain 10 that is cultivated on 1 / 4SDAY medium (glucose 10g / L, peptone 2.5g / L, yeast extract 5.0g / L, agar 18g / L, pH value is adjusted to 6.0). 5 Each spore was inoculated in 1.5ml 1 / 4SDAY liquid medium, cultured with shaking at 28°C at 250rpm for 3 days, and genomic DNA was extracted with a fungal gene DNA extraction kit (Bioflux, Hangzhou).

[0024] The cloned Magas1 gene sequence was compared with the existing Metarhizium anisopliae genome sequence to obtain the partial sequence upstream of the Magas1 gene, analyzed by the promoter prediction software, intercepted a sequence of 1222bp, and designed the primer PMagas1F5'CG Actagt TTGTACGGAGTACTCCAG ACGT3' (contains SpeI restriction site) and PMagas1R5'CA ggggccc GGATAAGGTAGGGGGTTTTGTA3' (contains ApaI restriction site). The extracted genomic DNA was used as a templat...

Embodiment 2

[0025] Embodiment 2: PMagas1-EGFP expression vector construction

[0026] Design primer EGFPF5'AT according to EGFP sequence ggggccc ATGGTGAGCAAGGGCGAGG3' (the underline is the ApaI restriction site) and EGFPR5'CA cccggg TTACTTGTACAGCTCGTCC3' (the underline is the SmaI restriction site), the EGFP sequence was amplified from the pEGFPN-1 plasmid (BD, USA), and the correctness of the sequence was verified by sequencing. The EGFP amplified product was cut with ApaI and SmaI and then inserted into PDPB-PMagas1 cut with ApaI and SmaI. Construction of PDPB-PMagas1-EGFP vector. After transformation of E. coli, plasmids were extracted. Use SpeI to cut the PDPB-PMagas1-EGFP vector, cut out the expression element PMagas1-EGFP, insert it into the pK2 vector containing Bar resistance, and construct the pK2-PMagas1-EGFP expression vector. The vector pattern is as follows figure 1 shown.

Embodiment 3

[0027] Embodiment 3: Transformation and identification of Metarhizium anisopliae with PMagas1-EGFP expression vector

[0028] The PMagas1-EGFP expression vector was transformed into Agrobacterium tumefaciens EAH105 strain (Beijing Dingguo) by electrotransformation, and then verified by PCR. Through the Agrobacterium-mediated method (Fang, W., Zhang, Y., Yang, X., Zheng, X., Duan, H., Li, Y., Pei, Y., 2004.Agrobacterium tumefaciens-mediated transformation of Beauveria bassiana using an herbicide resistance gene as a selection marker. J Invertebr Pathol 85, 18-24), transform Metarhizium anisopliae CQMa102. On Chase medium containing 80 μg / ml herbicide (sucrose 30g / L, NaNO 3 2g / L, KH 2 PO 4 1g / L, MgSO 4 0.5g / L, KCl 0.5g / L, FeSO 4 0.01g / L, agar 15g / L) to screen transformants. After culturing for 10 days, the transformants were selected and cultured on 1 / 4SDAY, the genomic DNA of the transformants was extracted with a fungal gene DNA extraction kit (Bioflux, Hangzhou), an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific promoter of pathogenic filamentous fungi. The nucleotide sequence of the specific promoter at least contains a DNA sequence represented by SEQ ID No.1, or a DNA sequence complementary to the sequence represented by the SEQ ID No.1, or a DNA sequence which is 90 or above familiar with the sequence represented by the SEQ ID No.1 or the complementary sequence of the sequence represented by the SEQ ID No.1 and has the same functions with the sequence represented by the SEQ ID No.1 or the complementary sequence of the sequence represented by the SEQ ID No.1. Experiment researches prove that the promoter can be specifically and effectively expressed in a period of appressorium. The promoter provides an important tool for studying the regulation of the pathogenic filamentous fungi in an appressorium formation and permeation into body wall of a host and reconstructing wild insect pathogenic strain gene engineering and has a very high application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a filamentous fungus-specific promoter and application thereof. Background technique [0002] When pathogenic filamentous fungi, including phytopathogenic fungi and entomopathogenic fungi, infect hosts, they first form appresses. The function of appressoria is to provide mechanical pressure and secrete hydrolytic enzymes to form infection spikes to penetrate the host body wall; thus, appressorium formation is critical for successful host infection by pathogenic filamentous fungi. At present, there have been some reports on gene expression during appressorium formation of pathogenic fungi, but there is no report on gene regulation during appressoria formation and differentiation. Contents of the invention [0003] The purpose of the present invention is to provide a specific promoter of pathogenic filamentous fungi, said promoter is from Metarhizium anisopliae, which ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/80C12N1/15C12R1/645
Inventor曹月青焦润夏玉先朱祥先
OwnerCHONGQING UNIV