Guzmania ACC oxidase gene and applications

A technology of pineapple and pineapple, which is applied to the key enzyme-ACC oxidase gene and its application field, and can solve the problems of delayed flowering of pineapple

Inactive Publication Date: 2012-12-05
ZHEJIANG XIAOSHAN COTTON & FLAX RES INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few related studies in ornamental pineapple, and there is no report in the open literature. There are only two partial cDNA fragments of ethylene response genes (AY263359, AY294285, 1) in the gene bank (GenBank), and ethylene biosynthesis-related genes (including ACC oxidase) and no

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Guzmania ACC oxidase gene and applications
  • Guzmania ACC oxidase gene and applications
  • Guzmania ACC oxidase gene and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] The applicant successfully constructed the full-length cDNA library of the early flower organ of Ostara cultivar Ostara, and sequenced it on a random scale (see the applicant's article for details). After Blast analysis, it was determined that three ESTs belonged to the ACO gene and belonged to the same Contig. That is: |ppfca0_001923.z1.scf|ppfca0_0002_G12.ab1|ppfca0_001745.z1.scf|, since the built library is a full-length cDNA library, a large part of the library is cloned as a full-length cDNA, so |ppfca0_001923 was randomly selected. z1.scf|Primer Walking sequencing method for monoclonal to detect all insert fragment information. Blast analysis (such as figure 1 , figure 2 ) shows that the sequence is the full-length cDNA of the ACO gene, with a full-length of 1504bp (SED ID NO: 1).

Embodiment 2

[0070] Based on the obtained full-length cDNA sequence, design specific primers from both ends:

[0071] S1-2: GGGGATTGTAGATTAGAGGCAATCG (SED ID NO: 4)

[0072] A1484-2: GCATAAAATCTGCTTCACAATAGATTACAC (SED ID NO:5)

[0073] Reagent: Long PCR Enzyme Mix (MBI, K0181)

[0074] PCR reaction system:

[0075]

[0076] PCR reaction program:

[0077]

[0078] Using the DNA extracted from Ostara as a template for PCR amplification, a 2500bp band with the expected length was obtained, and the band was cloned and sequenced according to the prevailing industry-wide cloning and sequencing methods, that is, gel cutting, recovery, and T-vector connection , transformation of Escherichia coli, screening of positive clones and other processes. The fragment was sequenced to obtain a 2546bp sequence. After analysis, the sequence was the DNA sequence corresponding to the full-length cDNA of the ACO gene. The DNA sequence: the sequence was 2546bp long and had three introns (SED ID NO: 3)....

Embodiment 3

[0080] In order to verify that the gene sequence can be expressed into a complete and effective protein, it will be expressed in prokaryotic, and the specific process is as follows:

[0081] Primer design: Synthesize primers according to the 954bp end sequence in cDNA and pET-28 vector MCS, and introduce enzyme cutting sites Nde I and SalI

[0082] F-ACO: GGAATTCCATATGGAGAGTAAATTCCCAATCATC (SED ID NO:6)

[0083] R-ACO: ACGCGTCGACTTACTAGGTTGCAATTGGCG (SED ID NO: 7)

[0084] Using DH10B (containing the target gene-PDNR-LIB vector) bacteria as a template, the pfu enzyme amplifies the target gene, recovers the PCR product, and uses Nde I and SalI (NEB) double enzymes designed by the primers to digest the purified PCR product and the pET-28 vector , connect the target fragment to the vector, transform DH5α competent cells, pick a single colony, and carry out colony PCR identification. Extract the plasmid for sequencing, and compare the sequencing result with the original inserte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of plant genetic engineering, in particular relates to a key enzyme-ACC oxidase gene of a guzmania ethylene synthesis approach and applications of the gene, and provides a guzmania ACC oxidase gene and applications of the gene. The gene is a key enzyme coding gene in a guzmania ethylene synthesis process, and has important application value in promoting the blossom in advance of the guzmania, namely a familiar molecular regulation and control technology in the industry to excessively express ACO gene (such as a sense RNA technology), and plant transformation can improve blossom in advance; and the expression inhibition of ACO gene (such as an antisense RNA technology and an RNAi technology) and plant transformation can prolong flowering enjoyment.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular, it relates to a key enzyme of the ethylene synthesis pathway of pineapples——ACC oxidase gene and its application. Background technique [0002] Pineapple is a very popular high-grade potted flower in the flower market in my country. It is native to the tropical regions of South America. This genus is the genus with the most cultivated varieties of ornamental pineapple on the market, and it belongs to the bromeliaceae plant like the edible pineapple-pineapple. [0003] As a plant hormone, ethylene plays a vital role in the whole life cycle of plants. It has a wide range of effects on plant seed germination, growth and development, senescence of leaves and flower organs, fruit ripening, and sex differentiation. ACC oxidase (ACC oxidase), also known as ethylene-forming enzyme (EFE), is a key enzyme in the ethylene synthesis pathway, which catalyzes the last step of ethylene s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53
Inventor 刘建新王炜勇沈福泉马广莹
Owner ZHEJIANG XIAOSHAN COTTON & FLAX RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap