Guzmania ACC oxidase gene and applications
A technology of pineapple and pineapple, which is applied to the key enzyme-ACC oxidase gene and its application field, and can solve the problems of delayed flowering of pineapple
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The applicant successfully constructed the full-length cDNA library of the early flower organ of Ostara cultivar Ostara, and sequenced it on a random scale (see the applicant's article for details). After Blast analysis, it was determined that three ESTs belonged to the ACO gene and belonged to the same Contig. That is: |ppfca0_001923.z1.scf|ppfca0_0002_G12.ab1|ppfca0_001745.z1.scf|, since the built library is a full-length cDNA library, a large part of the library is cloned as a full-length cDNA, so |ppfca0_001923 was randomly selected. z1.scf|Primer Walking sequencing method for monoclonal to detect all insert fragment information. Blast analysis (such as figure 1 , figure 2 ) shows that the sequence is the full-length cDNA of the ACO gene, with a full-length of 1504bp (SED ID NO: 1).
Embodiment 2
[0070] Based on the obtained full-length cDNA sequence, design specific primers from both ends:
[0071] S1-2: GGGGATTGTAGATTAGAGGCAATCG (SED ID NO: 4)
[0072] A1484-2: GCATAAAATCTGCTTCACAATAGATTACAC (SED ID NO:5)
[0073] Reagent: Long PCR Enzyme Mix (MBI, K0181)
[0074] PCR reaction system:
[0075]
[0076] PCR reaction program:
[0077]
[0078] Using the DNA extracted from Ostara as a template for PCR amplification, a 2500bp band with the expected length was obtained, and the band was cloned and sequenced according to the prevailing industry-wide cloning and sequencing methods, that is, gel cutting, recovery, and T-vector connection , transformation of Escherichia coli, screening of positive clones and other processes. The fragment was sequenced to obtain a 2546bp sequence. After analysis, the sequence was the DNA sequence corresponding to the full-length cDNA of the ACO gene. The DNA sequence: the sequence was 2546bp long and had three introns (SED ID NO: 3)....
Embodiment 3
[0080] In order to verify that the gene sequence can be expressed into a complete and effective protein, it will be expressed in prokaryotic, and the specific process is as follows:
[0081] Primer design: Synthesize primers according to the 954bp end sequence in cDNA and pET-28 vector MCS, and introduce enzyme cutting sites Nde I and SalI
[0082] F-ACO: GGAATTCCATATGGAGAGTAAATTCCCAATCATC (SED ID NO:6)
[0083] R-ACO: ACGCGTCGACTTACTAGGTTGCAATTGGCG (SED ID NO: 7)
[0084] Using DH10B (containing the target gene-PDNR-LIB vector) bacteria as a template, the pfu enzyme amplifies the target gene, recovers the PCR product, and uses Nde I and SalI (NEB) double enzymes designed by the primers to digest the purified PCR product and the pET-28 vector , connect the target fragment to the vector, transform DH5α competent cells, pick a single colony, and carry out colony PCR identification. Extract the plasmid for sequencing, and compare the sequencing result with the original inserte...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap