Guzmania ACC oxidase gene and applications
A technology of pineapple and pineapple, which is applied to the key enzyme-ACC oxidase gene and its application field, and can solve the problems of delayed flowering of pineapple
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The applicant successfully constructed the full-length cDNA library of the early flower organ of Ostara cultivar Ostara, and sequenced it on a random scale (see the applicant's article for details). After Blast analysis, it was determined that three ESTs belonged to the ACO gene and belonged to the same Contig. That is: |ppfca0_001923.z1.scf|ppfca0_0002_G12.ab1|ppfca0_001745.z1.scf|, since the built library is a full-length cDNA library, a large part of the library is cloned as a full-length cDNA, so |ppfca0_001923 was randomly selected. z1.scf|Primer Walking sequencing method for monoclonal to detect all insert fragment information. Blast analysis (such as figure 1 , figure 2 ) shows that the sequence is the full-length cDNA of the ACO gene, with a full-length of 1504bp (SED ID NO: 1).
Embodiment 2
[0070] Based on the obtained full-length cDNA sequence, design specific primers from both ends:
[0071] S1-2: GGGGATTGTAGATTAGAGGCAATCG (SED ID NO: 4)
[0072] A1484-2: GCATAAAATCTGCTTCACAATAGATTACAC (SED ID NO:5)
[0073] Reagent: Long PCR Enzyme Mix (MBI, K0181)
[0074] PCR reaction system:
[0075]
[0076] PCR reaction program:
[0077]
[0078] Using the DNA extracted from Ostara as a template for PCR amplification, a 2500bp band with the expected length was obtained, and the band was cloned and sequenced according to the prevailing industry-wide cloning and sequencing methods, that is, gel cutting, recovery, and T-vector connection , transformation of Escherichia coli, screening of positive clones and other processes. The fragment was sequenced to obtain a 2546bp sequence. After analysis, the sequence was the DNA sequence corresponding to the full-length cDNA of the ACO gene. The DNA sequence: the sequence was 2546bp long and had three introns (SED ID NO: 3)....
Embodiment 3
[0080] In order to verify that the gene sequence can be expressed into a complete and effective protein, it will be expressed in prokaryotic, and the specific process is as follows:
[0081] Primer design: Synthesize primers according to the 954bp end sequence in cDNA and pET-28 vector MCS, and introduce enzyme cutting sites Nde I and SalI
[0082] F-ACO: GGAATTCCATATGGAGAGTAAATTCCCAATCATC (SED ID NO:6)
[0083] R-ACO: ACGCGTCGACTTACTAGGTTGCAATTGGCG (SED ID NO: 7)
[0084] Using DH10B (containing the target gene-PDNR-LIB vector) bacteria as a template, the pfu enzyme amplifies the target gene, recovers the PCR product, and uses Nde I and SalI (NEB) double enzymes designed by the primers to digest the purified PCR product and the pET-28 vector , connect the target fragment to the vector, transform DH5α competent cells, pick a single colony, and carry out colony PCR identification. Extract the plasmid for sequencing, and compare the sequencing result with the original inserte...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 