Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing Porcine circovirus type 2 antigen with chloroplast and its product

A porcine circovirus and chloroplast technology, applied in the directions of virus antigen components, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of cross-reaction of safety risks, non-specific immunity, high production cost, and achieve good immune effect. , to achieve the effect of molecular operation and simple structure

Inactive Publication Date: 2012-01-11
ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The technical problem to be solved by the present invention is to overcome defects such as low yield, high production cost, and certain safety risks (possibility of cross-reaction and non-specific immunity) existing in the preparation method of the existing PCV2 vaccine, and provide A new preparation method of PCV2 vaccine, which uses plant chloroplast as a bioreactor to express porcine circovirus type II antigen, and has many advantages such as high yield, low cost, and good safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing Porcine circovirus type 2 antigen with chloroplast and its product
  • Method for preparing Porcine circovirus type 2 antigen with chloroplast and its product
  • Method for preparing Porcine circovirus type 2 antigen with chloroplast and its product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction and transformation of porcine circovirus type II ORF2 gene Chlamydomonas chloroplast expression vector and identification of transgenic Chlamydomonas

[0036] 1. Cloning of porcine circovirus type II antigenic protein ORF2 gene

[0037] 1.1 Obtaining the target gene

[0038] Extraction of porcine circovirus DNA: from typical diseased pig samples, the samples were processed according to the instructions of the PCV2 detection kit (Century Yuanheng Company), and the DNA was extracted as a template.

[0039] According to the sequence of the known porcine circovirus type II ORF2 gene, primers were designed respectively, and the SalI site and the SphI site were introduced respectively, and two pairs of primers were as follows:

[0040] PCVFP:G GTC GAC ATGAATGGCATCTTCAACACCC Sal I

[0041] PCVRP: G GCATGC TTAGGGTTTAAGTGGGGGGTC SphI

[0042] Add the following components to a 0.5 mL eppendorf tube:

[0043]

[0044] Reaction procedure:

[0045] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a Porcine circovirus type 2 antigen with chloroplast and its product. The preparation method comprises the steps of: (1) constructing a Chlamydomonas chloroplast expression vector of a Porcine circovirus type 2 antigen gene; (2) conversing the Chlamydomonas chloroplast expression vector into Chlamydomonas, and conducting screening so as to obtain transgenic Chlamydomonas; (3) culturing the transgenic Chlamydomonas, and collecting expressed recombinant protein, thus obtaining the antigen. The method of the invention employs a Chlamydomonas chloroplast expression system to produce the Porcine circovirus type 2 antigen in a Chlamydomonas bioreactor, and the expressed recombinant protein has high specificity, good immune effect and generate no non-purposive immune reaction. The preparation method provided in the invention can greatly reduce the production cost of the Porcine circovirus type 2 antigen, and has many advantages like safety, high efficiency, less energy consumption and low cost.

Description

technical field [0001] The invention relates to a method for preparing an antigen, in particular to a method for preparing porcine circovirus type II antigen by using Chlamydomonas chloroplast, and belongs to the field of preparation of porcine circovirus type II antigen. Background technique [0002] Porcine circovirus type 2 (PCV2) is the main pathogen of related diseases such as Postweaning multisystemic wasting syndrome (PMWS) in weaned piglets. A body, single-stranded circular DNA virus with a full-length genome of 1,767bp or 1,768bp, including 11 reading frames. However, there are only two clearly encoded products in the genome, namely: rep (replication-associated protein) and cap (nucleocapsid protein). There are two types of PCV: PCV1 and PCV2; PCV1 has no obvious pathogenic evidence, and now the main research is still PCV2. [0003] PCV2 is widespread and can cause huge losses to the swine industry. At present, the vaccines for preventing and treating PCV2 mainly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C07K14/01A61K39/12A61P31/20C12R1/89C12R1/93
Inventor 李轶女张志芳王金辉程奇王国增沈桂芳倪丕冲
Owner ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com