Modified sacB gene and derived integrated vector thereof
An integrated, genetic technology, applied in genetic engineering, plant genetic improvement, and the use of vectors to introduce foreign genetic material, etc., can solve problems such as troublesome experiments and limited application range, and achieve the effect of reducing trouble and expressing well
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0010] Example 1 Modified sacB gene
[0011] A modified sacB gene whose nucleotide sequence is shown in SEQ ID NO.1.
Embodiment 2
[0012] Example 2 Construction of integrated vector pDXW-3
[0013] Using B. subtilis subsp.168 (purchased from ATCC 23857) genome as template, PlacM-sacB-F and PlacM-sacB-R as primers, the 1605 bp sacB gene was amplified by PCR. The 5'and 3' Restriction enzymes NheI and NcoI were introduced into the end, and the PCR product was digested with NheI and NcoI. pDWX-1 (Refer to Xu, D., Tan, Y., Li, Y., Wang, X., 2011. Construction of a hovel promoter-probe vector and its application for screening strong promoter for Brevibacterium flavum metabolic engineering. World Journal of Microbiology and Biotechnology. 27, 961-968.) was also digested with NheI and NcoI; the two were ligated, and the resulting plasmid size was 5067bp, named pDXW-3.
[0014] The primer sequence required for PCR amplification as described above:
[0015] PlacM-sacB-F: aaatt gctagc tgagctgtttacaattaatcatcgtgtggtaccatgtgtggaattggaaaggacttgaacgatgaacatcaaaaagtt NheI site is underlined.
[0016] PlacM-sacB-R: agta ccatg...
Embodiment 3
[0019] Example 3 Evaluation of the application of vector pDXW-3 in Corynebacterium glutamicum
[0020] To prove the availability of pDXW-3, we knocked out the aceE gene in Corynebacterium glutamicum. Using the Corynebacterium glutamicum genome as a template, aceE-L-F / aceE-L-R and aceE-R-F / aceE-R-R were used as primers, respectively, the upstream homology arm Larm and the downstream homology arm Ram of the aceE gene were amplified by PCR.
[0021] aceE-L-F: CAC AGATCT GATTGTTAAGGCTTCTTGTTTCCACGCT, where the underlined part is the BglII site
[0022] aceE-L-R: TCTATGACAGTGAGTACTCGAACGACAGCAA GCTTGATCGGCCATTTCCACACCTCC, where the underlined part and the primer aceE-R-F underlined part are reverse complementary sequences
[0023] aceE-R-F: TTGCTGTCGTTCGAGTACTCACTGTCATAGA GACTTCTCCACTGATCTGCCAAACC
[0024] aceE-R-R: AAA CTCGAG TTCTTCCCCGGCACTGTGAATGAGC where the underlined part is the XhoI site.
[0025] After the two fragments of Larm and Ram were purified, the second round of PCR was ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com