Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Modified sacB gene and derived integrated vector thereof

An integrated, genetic technology, applied in genetic engineering, plant genetic improvement, and the use of vectors to introduce foreign genetic material, etc., can solve problems such as troublesome experiments and limited application range, and achieve the effect of reducing trouble and expressing well

Inactive Publication Date: 2012-01-25
JIANGNAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The vector uses the promoter and SD sequence of sacB itself, which limits the scope of application; when the vector is used for gene knockout, due to the insertion of the IS insert fragment, different proportions of sucrose-resistant and antibiotic-resistant colonies appear, which brings a negative impact on the experiment. come to unnecessary trouble

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified sacB gene and derived integrated vector thereof
  • Modified sacB gene and derived integrated vector thereof
  • Modified sacB gene and derived integrated vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0010] Example 1 Modified sacB gene

[0011] A modified sacB gene whose nucleotide sequence is shown in SEQ ID NO.1.

Embodiment 2

[0012] Example 2 Construction of integrated vector pDXW-3

[0013] Using B. subtilis subsp.168 (purchased from ATCC 23857) genome as template, PlacM-sacB-F and PlacM-sacB-R as primers, the 1605 bp sacB gene was amplified by PCR. The 5'and 3' Restriction enzymes NheI and NcoI were introduced into the end, and the PCR product was digested with NheI and NcoI. pDWX-1 (Refer to Xu, D., Tan, Y., Li, Y., Wang, X., 2011. Construction of a hovel promoter-probe vector and its application for screening strong promoter for Brevibacterium flavum metabolic engineering. World Journal of Microbiology and Biotechnology. 27, 961-968.) was also digested with NheI and NcoI; the two were ligated, and the resulting plasmid size was 5067bp, named pDXW-3.

[0014] The primer sequence required for PCR amplification as described above:

[0015] PlacM-sacB-F: aaatt gctagc tgagctgtttacaattaatcatcgtgtggtaccatgtgtggaattggaaaggacttgaacgatgaacatcaaaaagtt NheI site is underlined.

[0016] PlacM-sacB-R: agta ccatg...

Embodiment 3

[0019] Example 3 Evaluation of the application of vector pDXW-3 in Corynebacterium glutamicum

[0020] To prove the availability of pDXW-3, we knocked out the aceE gene in Corynebacterium glutamicum. Using the Corynebacterium glutamicum genome as a template, aceE-L-F / aceE-L-R and aceE-R-F / aceE-R-R were used as primers, respectively, the upstream homology arm Larm and the downstream homology arm Ram of the aceE gene were amplified by PCR.

[0021] aceE-L-F: CAC AGATCT GATTGTTAAGGCTTCTTGTTTCCACGCT, where the underlined part is the BglII site

[0022] aceE-L-R: TCTATGACAGTGAGTACTCGAACGACAGCAA GCTTGATCGGCCATTTCCACACCTCC, where the underlined part and the primer aceE-R-F underlined part are reverse complementary sequences

[0023] aceE-R-F: TTGCTGTCGTTCGAGTACTCACTGTCATAGA GACTTCTCCACTGATCTGCCAAACC

[0024] aceE-R-R: AAA CTCGAG TTCTTCCCCGGCACTGTGAATGAGC where the underlined part is the XhoI site.

[0025] After the two fragments of Larm and Ram were purified, the second round of PCR was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a modified sacB gene and a derived integrated vector thereof, and belongs to the technical field of gene engineering. The integrated vector contains a gene sacB, a resistance marker kanamycin marked resistance gene and a multi-cloning site (MCS), wherein the gene sacB is artificially synthesized and promoted by a strong promoter PlacM, can be well transcribed and expressed in corynebacteria and has conditional lethal function; and the resistance marker kanamycin marked resistance gene is used for corynebacteria transformant selection. The sacB has better expression under the strong promoter PlacM and the optimized SD; and moreover, because the promoter and sacR and SD sequences of the sacB are removed, colonies of sucrose resistance and antibiotic resistance are nearly not produced in application, and unnecessary trouble in application is greatly reduced. The vector can be duplicated and stabilized in escherichia coli, cannot be duplicated in the corynebacteria, and is suitable for knockout and substitution of corynebacteria chromogenes.

Description

Technical field [0001] The invention relates to a modified gene and an integrated vector constructed on the basis of the modified gene, in particular to a modified sacB gene and an integrated vector derived therefrom. Background technique [0002] With the accumulation of knowledge of corynebacterium physiology, biochemistry and genetics, metabolic engineering breeding based on rational design plays an increasingly important role in the selection of high-yielding amino acid strains. Gene knockout and replacement technology is one of the main molecular biology techniques in the research of metabolic engineering breeding of coryneform bacteria. Gene knockout and replacement technology is a molecular biology technology that has been developed since the 1980s, in which specific genes in the body are inactivated or deleted or replaced by others through certain means. Generally, the homologous recombination system in the microorganism is used to cause homologous recombination between ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/77C12R1/15C12N15/54C12N15/63C12Q1/68
Inventor 王小元谭延振徐大庆李烨
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com