Bacterium for reducing mercury pollution in seawater and application thereof

A technology for mercury pollution and seawater, applied in the direction of water pollutants, bacteria, water/sewage treatment, etc., to achieve rapid removal and high safety effects

Active Publication Date: 2012-03-14
YANTAI INST OF COASTAL ZONE RES CHINESE ACAD OF SCI
View PDF3 Cites 59 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Retrieval of relevant materials including Chinese patents shows that the isolation of mercury-resistant Pseudomonas putida from seawater environment and the use of this bacteria to remove mercury pollution in marine environment have not seen the same or similar reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacterium for reducing mercury pollution in seawater and application thereof
  • Bacterium for reducing mercury pollution in seawater and application thereof
  • Bacterium for reducing mercury pollution in seawater and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Screening of strains with higher resistance to mercury compounds and identification of 16S rRNA strains.

[0024] Collect the bottom mud from Yantai sea area, and apply it on the surface containing 5ppm HgCl 2 In the solid medium of 28 ~ 30 ° C incubator for 36 hours, the clones that form colonies on the plate are the clones that are resistant to HgCl 2 resistant colonies. Prepare different concentrations of HgCl 2 solution, the bacteria were measured for HgCl 2 The MIC value of the resistance is 80ppm, which belongs to HgCl 2 Bacteria with high resistance. The bacterium was named Pseudomonasputida (SP1). The genomic DNA of the strain was extracted, and its 16S rRNA was amplified by PCR with 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACG ACTT) for identification. The conditions of PCR were: denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 57°C for 1 min, extension at 72°C for 1 min, starting from the second step, 30 cycles. PCR pr...

Embodiment 2

[0029] PCR cloning of the mer operon associated with SP1 mercury resistance.

[0030]SP1 has the characteristic of actively resisting mercury, indicating that there are resistance genes related to bacterial mercury resistance in vivo. We designed primers to clone the mer operon gene of SP1 according to the sequence of the mer operon of the gene related to bacterial mercury resistance that has been reported. A total of 3 pairs of primers were designed for PCR. Primer F1 (TAAGACTGCTGCTGGTAGTGGGTG) / R2 (GCGAGCCGCTTAGGGATTGTAT), PCR conditions: 94°C pre-denaturation for 4 minutes, 94°C denaturation for 30 seconds, 55°C annealing for 1 minute, 72°C extension for 3 minutes, starting from the second step, 30 cycles. Primer F2 (TGCTGCCTCTGTTTGCTGGACT) / R3 (GCCCGATACCGGACTCAAAGG), PCR conditions: 94°C pre-denaturation for 4 minutes, 94°C denaturation for 30 seconds, 57°C annealing for 1 minute, 72°C extension for 3 minutes, starting from the second step, 30 cycles. Primer merCF1(CATATGG...

Embodiment 3

[0099] Resistance of SP1 to other heavy metals and antibiotics.

[0100] To determine the resistance of SP1 to other heavy metals and antibiotics, the following heavy metals and antibiotics were used to test: CdCl 2 、CoCl 2 , CrCl 3 , CuCl 2 , PbCl 2 , ZnSO 4 And ampicillin (Ap), kanamycin (Kn), chloramphenicol (Cm), tetracycline (Tc). SP1 in the final concentrations of 0.1mM, 0.5mM, 1mM, 5mM, 10mM heavy metals and 20ug / ml, 40ug / ml, 60ug / ml, 100ug / ml, 200ug / ml, 300ug / ml, 400ug / ml antibiotics After culturing in 2216E medium at 28-30°C for 24 hours, observe the growth of SP1, and take the maximum concentration of heavy metals and antibiotics at which bacteria can grow significantly as the minimum inhibitory concentration of heavy metals and antibiotics on SP1. The results are shown in Table 1. SP1 can survive in an environment containing high concentrations of heavy metals and antibiotics, indicating that SP1 has a strong ability to adapt to the environment and can survive...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, relating to the field of environmental improvement by using environmental microorganism, particularly discloses a bacterium for reducing mercury pollution in seawater and an application thereof. The bacterium for reducing mercury pollution in seawater is Pseudomonasputida SP1, preserved in China General Microbiological Culture Collection Center (CGMCC) on Jun.1,2010 under the preservation number of CGMCC No.3887. The bacterium Pseudomonasputida SP1 can remove mercury from seawater. The use of the bacterial strain SP1 in removing mercury pollution from seawater has the advantages of high efficiency, low nutritional requirement, simple operation, high safety and the like. Compared with other processes, the cost of treating mercury pollution in seawater is greatly reduced, andthe efficiency of treating mercury pollution in seawater is raised.

Description

technical field [0001] The invention relates to the field of environmental treatment by using environmental microorganisms, in particular to a bacterium for reducing mercury pollution in seawater and its application. Background technique [0002] Mercury pollution is one of the most harmful heavy metal pollutants in the environment. Various forms of mercury in the environment, especially methylmercury, if not removed in time, will be ingested by humans through the food chain and enter the brain and other parts of the human body, causing damage to the body such as slurred speech, trembling hands and feet, and neurological disorders. Mercury pollution in the coastal environment is very easy to cause because mercury pollutants continue to flow to estuaries and bays and accumulate in sediments. [0003] Although mercury is harmful to most organisms, there are still bacteria that can grow and reproduce in a higher mercury concentration (ppm level) environment, and these bacteria...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C02F3/34C02F1/62C12R1/40C02F101/20
Inventor陈令新张卫卫
OwnerYANTAI INST OF COASTAL ZONE RES CHINESE ACAD OF SCI