Unlock instant, AI-driven research and patent intelligence for your innovation.

Methylated DNA (Deoxyribonucleic Acid) detection method based on endonuclease digestion

An endonuclease and detection method technology, applied in the field of detection of methylated DNA, can solve the problems of inapplicable mixed samples, large sample size, and easy interference, so as to achieve the goal of not being easily interfered, requiring small sample size, The effect of improving sensitivity

Active Publication Date: 2012-04-04
江苏元丞生物科技有限公司
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The invention provides a method for detecting methylated DNA, which can effectively separate methylated DNA and unmethylated DNA, and solves the limitations of the prior art, complicated methods, large sample size, and easy to be detected. Disadvantages such as interference and inapplicability to mixed samples, you can use a fully automatic DNA sequence analyzer when analyzing DNA methylation, which improves the sensitivity of detection while maintaining its reliability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methylated DNA (Deoxyribonucleic Acid) detection method based on endonuclease digestion
  • Methylated DNA (Deoxyribonucleic Acid) detection method based on endonuclease digestion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach ( 1

[0031] Step 1, Treat with sulfite and standard unmethylated DNA with standard methylated DNA.

[0032] Wherein, the sulfite is specifically sodium sulfite; the DNA to be tested treated with sulfite can be specifically a human genome gene. The step of treating the DNA to be tested with sulfite is as follows: denature the DNA to be tested with 0.3M NaOH, add a mixed solution containing 5M sodium sulfite and 0.5mM hydroquinone with a pH value of 5.0, and incubate at 60°C for 4 hours in the dark; Desulfurize and purify DNA. The unmethylated cytosine (C) in the DNA to be tested is converted into uracil (U) through the above treatment process, and the methylated cytosine (C) remains unchanged.

[0033] Wherein said standard unmethylated DNA and standard methylated DNA refer to known pure unmethylated DNA and methylated DNA.

[0034] Step 2, designing and synthesizing PCR primers.

[0035] In the target region to be detected, select a sequence rich in CpG sites, use the part of th...

Embodiment approach ( 2

[0054] On the basis of embodiment (1), DNA extracted from actual clinical samples was used as the sample to be tested, and the practicability of the present invention was tested under the same conditions as the above embodiment (1).

[0055] Among them, the same conditions as in the above-mentioned embodiment (1) mean that all operations are the same as the above-mentioned embodiment (1) except that the DNA extracted from the actual clinical sample is used as the sample to be tested.

[0056] The clinically extracted DNA samples to be tested are human normal and cancer cell DNA, tumor tissue genomic DNA, blood cell DNA, serum DNA, various body fluid DNA or various excrement DNA samples.

[0057] The cancer cells can be lung cancer cells, gastric cancer cells, colon cancer cells, rectal cancer cells, liver cancer cells, breast cancer cells, lymphoma cells, bladder cancer cells, ovarian cancer cells, kidney cancer cells or pancreatic cancer cells; The tissue can be lung cancer t...

Embodiment approach ( 3

[0059] On the basis of the implementation methods (1) and (2), taking the sequence of the transcription promoter region of the P16 gene as an example, the specific PCR primers are designed as follows:

[0060] Methylation of the transcription promoter region of P16 gene is a characteristic of many cancer cells such as lung cancer. The sequence of the transcription promoter region of the P16 gene is as follows:

[0061] Homo sapiens p16 protein (CDKN2A) gene, CpG island and partial cds, DQ325544.1

[0062] CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGCGCTGCCCAACGCACCGAATAGGATTACGCCG

[0063] Methylated DNA sequence, the underlined part is the region to be detected;

[0064] CGGATCGCGTGCGTTCGGCG GTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGGCGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGGTTACGGTCGCGGTTCGGGTTCGGGTAGAGGAGGTGCGGGCGTTGTTGGAGGCGGGGGCGTTGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a methylated DNA (Deoxyribonucleic Acid) detection method which comprises the following steps of: (1) treating DNA to be detected, standard methylated DNA and non-methylated DNA by using sulfite; (2) synthesizing a PCR (Polymerase Chain Reaction) primer with a tailed primer sequence; (3) amplifying the standard methylated DNA and non-methylated DNA samples, and determining the melting temperature of the amplification product; (4) amplifying the DNA sample to be detected; (5) heating the DNA amplification product to be detected to a certain temperature; (6) digesting the DNA amplification product to be detected; (7) carrying out second PCR amplification by using a tailed sequence with a fluorescent mark; and (8) determining the electrophoretic mobility, and judging whether the sample contains methylated DNA. The invention has the advantages of large application scope, simple method and the like, the methylated DNA detection method requires small sample size, is not easy to be interfered and is applicable to mixed samples. The methylated DNA detection method has important significance in the fields of early detection, individualized treatment, condition judgment, relapse monitoring and the like for tumors.

Description

technical field [0001] The invention relates to a method for detecting methylated DNA, in particular to a method for detecting methylated DNA that is not susceptible to interference. Background technique [0002] DNA methylation refers to the modification of a methyl group on the 5' carbon of the cytosine (C) residue at the CpG site on the DNA chain. DNA methylation is one of the first DNA modifications discovered and is an important part of epigenetics. DNA methylation characteristically occurs on the cytosine residues of CpG dinucleotides on the DNA strand, which is commonly found in the expression regulatory sequences at the 5' end of genes. DNA methylation plays an important role in the regulation of gene expression, and is involved in animal embryonic development, gene imprinting, and X chromosome inactivation. Studies have shown that changes in DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability and protein interaction, thereby c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/44
Inventor 王建
Owner 江苏元丞生物科技有限公司