Methylated DNA Detection Method Based on Endonuclease Digestion

An endonuclease and detection method technology, applied in the field of detection of methylated DNA, can solve the problems of inapplicable mixed samples, large sample size, and complicated methods, and achieve the goal of not being easily disturbed, requiring small sample sizes, and methods simple effect

Active Publication Date: 2016-06-29
江苏元丞生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The invention provides a method for detecting methylated DNA, which can effectively separate methylated DNA and unmethylated DNA, and solves the limitations of the prior art, complicated methods, large sample size, and easy to be detected. Disadvantages such as interference and inapplicability to mixed samples, you can use a fully automatic DNA sequence analyzer when analyzing DNA methylation, which improves the sensitivity of detection while maintaining its reliability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methylated DNA Detection Method Based on Endonuclease Digestion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach （ 1

[0031] Step 1, Treat with sulfite and standard unmethylated DNA with standard methylated DNA.

[0032] Wherein, the sulfite is specifically sodium sulfite; the DNA to be tested treated with sulfite can be specifically a human genome gene. The treatment steps of the sulfite treatment of the DNA to be tested are as follows: denature the DNA to be tested with 0.3M NaOH, add a mixed solution containing 5M sodium sulfite and 0.5mM hydroquinone with a pH value of 5.0, and incubate at 60°C for 4 hours in the dark; desulfurization and purify the DNA. The unmethylated cytosine (C) in the DNA to be tested is converted into uracil (U) through the above treatment process, and the methylated cytosine (C) remains unchanged.

[0033] Wherein said standard unmethylated DNA and standard methylated DNA refer to known pure unmethylated DNA and methylated DNA.

[0034] Step 2, designing and synthesizing PCR primers.

[0035] In the target region to be detected, select a sequence rich in CpG si...

Embodiment approach （ 2

[0054] On the basis of embodiment (1), DNA extracted from actual clinical samples was used as the sample to be tested, and the practicability of the present invention was tested under the same conditions as the above embodiment (1).

[0055] Among them, the same conditions as in the above-mentioned embodiment (1) mean that all operations are the same as the above-mentioned embodiment (1) except that the DNA extracted from the actual clinical sample is used as the sample to be tested.

[0056] The clinically extracted DNA samples to be tested are human normal and cancer cell DNA, tumor tissue genomic DNA, blood cell DNA, serum DNA, various body fluid DNA or various excrement DNA samples.

[0057] The cancer cells can be lung cancer cells, gastric cancer cells, colon cancer cells, rectal cancer cells, liver cancer cells, breast cancer cells, lymphoma cells, bladder cancer cells, ovarian cancer cells, kidney cancer cells or pancreatic cancer cells; The tissue can be lung cancer t...

Embodiment approach （ 3

[0059] On the basis of the implementation methods (1) and (2), taking the sequence of the transcription promoter region of the P16 gene as an example, the specific PCR primers are designed as follows:

[0060] Methylation of the transcription promoter region of P16 gene is a characteristic of many cancer cells such as lung cancer. The sequence of the transcription promoter region of the P16 gene is as follows:

[0061] Homosapiensp16protein (CDKN2A) gene, CpGislandandpartialcds, DQ325544.1

[0062] CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGCGCTGCCCAACGCACCGAATAGGATTACGCCG

[0063] Methylated DNA sequence, the underlined part is the region to be detected;

[0064] CGGATCGCGTGCGTTCGGCG GTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGG CGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGGTTACGGTCGCGGTTCGGGTTCGGGTAGAGGAGGTGCGGGCG TTGTTGGAGGCGGGGGCGTTGTTTAA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for detecting methylated DNA. The steps include: step 1, treating DNA to be tested and standard methylated DNA and unmethylated DNA with sulfite; step 2, synthesizing PCR primers with tail primer sequences ; Step 3, amplifying standard methylated DNA and unmethylated DNA samples, and measuring the melting temperature of the amplified product; Step 4, amplifying the DNA sample to be tested; Step 5, heating the amplified DNA product to be tested to A specific temperature; step 6, digest; step 7, carry out the second PCR amplification with fluorescently labeled tail primers; step 8, measure the electrophoretic mobility, and determine whether the sample contains methylated DNA. The methylated DNA detection method of the present invention has the advantages of wide application range, simple method, small sample size required, not easily disturbed, applicable to mixed samples, etc., and can be used in early detection, personalized treatment, disease judgment and recurrence monitoring of various tumor diseases etc. are of great significance.

Description

technical field [0001] The invention relates to a method for detecting methylated DNA, in particular to a method for detecting methylated DNA that is not susceptible to interference. Background technique [0002] DNA methylation refers to the modification of a methyl group on the 5' carbon of the cytosine (C) residue at the CpG site on the DNA chain. DNA methylation is one of the first DNA modifications discovered and is an important part of epigenetics. DNA methylation characteristically occurs on the cytosine residues of CpG dinucleotides on the DNA strand, which is commonly found in the expression regulatory sequences at the 5' end of genes. DNA methylation plays an important role in the regulation of gene expression, and is involved in animal embryonic development, gene imprinting, and X chromosome inactivation. Studies have shown that changes in DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability and protein interaction, thereby c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/44
Inventor 王建
Owner 江苏元丞生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap