Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction

A detection method, polymerase technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of low detection sensitivity, complicated methods, easy to be interfered, etc., and achieve simple methods, small sample size, and difficult disturbed effect

Inactive Publication Date: 2012-04-04
上海迦美生物科技有限公司
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can effectively eliminate the influence of non-methylated DNA, enrich the methylated DNA in the sample, and solve the shortcomings of existing technologies such as low detection sensitivity, complicated methods, and easy interference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction
  • Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach （ 1

[0025] Step 1: Treat and purify known standards of unmethylated and methylated DNA using sulfite. Mix a certain amount of standard unmethylated DNA treated with sodium sulfite with serially diluted standard methylated DNA treated with sodium sulfite as the sample to be tested.

[0026] Wherein, the sulfite is specifically sodium sulfite; the DNA to be tested treated with sulfite can be specifically a human genome gene. The step of treating the DNA to be tested with sulfite is as follows: denature the DNA to be tested with 0.3M NaOH, add a mixed solution with a pH value of 5.0 consisting of 5M sodium sulfite and 0.5mM hydroquinone, and incubate at 60°C for 4 hours in the dark; Desulfurize and purify DNA.

[0027] Step 2: In the gene sequence to be detected, select a sequence as the target detection sequence, so that this sequence contains at least one CpG site, and this CpG site is located in the middle of the sequence or close to 3 ’ The position of the end; at the same time...

Embodiment approach （ 2

[0033] On the basis of embodiment (1), DNA extracted from actual clinical samples was used as the sample to be tested, and the practicability of the present invention was tested under the same conditions as the above embodiment (1).

[0034] Among them, the same conditions as in the above-mentioned embodiment (1) mean that all operations are the same as the above-mentioned embodiment (1) except that the DNA extracted from the actual clinical sample is used as the sample to be tested.

[0035] The clinically extracted DNA samples to be tested are human normal and cancer cell DNA, tumor tissue genomic DNA, blood cell DNA, serum DNA, various body fluid DNA or various excrement DNA samples.

[0036] The cancer cells can be lung cancer cells, gastric cancer cells, colon cancer cells, rectal cancer cells, liver cancer cells, breast cancer cells, lymphoma cells, bladder cancer cells, ovarian cancer cells, kidney cancer cells or pancreatic cancer cells; The tissue can be lung cancer tis...

Embodiment approach （ 3

[0038] On the basis of the implementation methods (1) and (2), taking the sequence of the transcription promoter region of the P16 gene as an example, the specific PCR primers are designed as follows:

[0039] Methylation of the transcription promoter region of P16 gene is a characteristic of many cancer cells such as lung cancer. The sequence of the transcription promoter region of the P16 gene is as follows, and the underlined part is the selected region to be detected.

[0040] Homo sapiens p16 protein (CDKN2A) gene, CpG island and partial cds, DQ325544.1

[0041] CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGCGCTGCCCAACGCACCGAATAGGATTACGCCG

[0042] Methylated DNA sequence, the underlined part is the selected detection region, bold U Unmethylated "C" converted to uracil by sodium sulfite treatment

[0043] U GGA UU GCGTGCGCT U GGCGGCTGCGGAGAGGGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a methylated DNA (Deoxyribonucleic Acid) detection method which comprises the following steps of: (1) treating DNA to be detected by using sulfite; (2) selecting a segment of consecutive sequence in a target region to be detected to synthesize a PCR (Polymerase Chain Reaction) primer; (3) carrying out a PCR reaction by using specific DNA polymerase sensitive to uracil to detect an amplification reaction signal; and (4) analyzing the reaction result of a PCR amplification instrument and judging whether methylated DNA exists in the sample. The invention has the advantages of large application scope, simple method and the like, the methylated DNA detection method requires small sample size, is not easy to be interfered and is applicable to mixed samples. The methylated DNA detection method has important significance in the fields of early detection, individualized treatment, condition judgment, relapse monitoring and the like for tumors.

Description

technical field [0001] The invention relates to a method for detecting methylated DNA, in particular to a method for detecting methylated DNA that has a wide application range and is less susceptible to interference. Background technique [0002] DNA methylation refers to the modification of a methyl group on the 5' carbon of the cytosine (C) residue at the CpG site on the DNA chain. DNA methylation is one of the first DNA modifications discovered and is an important part of epigenetics. DNA methylation characteristically occurs on the cytosine residues of CpG dinucleotides on the DNA strand, which is commonly found in the expression regulatory sequences at the 5' end of genes. DNA methylation plays an important role in the regulation of gene expression, and is involved in animal embryonic development, gene imprinting, and X chromosome inactivation. Studies have shown that changes in DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 王建
Owner 上海迦美生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com