Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction
A detection method, polymerase technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of low detection sensitivity, complicated methods, easy to be interfered, etc., and achieve simple methods, small sample size, and difficult disturbed effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach ( 1
[0025] Step 1: Treat and purify known standards of unmethylated and methylated DNA using sulfite. Mix a certain amount of standard unmethylated DNA treated with sodium sulfite with serially diluted standard methylated DNA treated with sodium sulfite as the sample to be tested.
[0026] Wherein, the sulfite is specifically sodium sulfite; the DNA to be tested treated with sulfite can be specifically a human genome gene. The step of treating the DNA to be tested with sulfite is as follows: denature the DNA to be tested with 0.3M NaOH, add a mixed solution with a pH value of 5.0 consisting of 5M sodium sulfite and 0.5mM hydroquinone, and incubate at 60°C for 4 hours in the dark; Desulfurize and purify DNA.
[0027] Step 2: In the gene sequence to be detected, select a sequence as the target detection sequence, so that this sequence contains at least one CpG site, and this CpG site is located in the middle of the sequence or close to 3 ’ The position of the end; at the same time...
Embodiment approach ( 2
[0033] On the basis of embodiment (1), DNA extracted from actual clinical samples was used as the sample to be tested, and the practicability of the present invention was tested under the same conditions as the above embodiment (1).
[0034] Among them, the same conditions as in the above-mentioned embodiment (1) mean that all operations are the same as the above-mentioned embodiment (1) except that the DNA extracted from the actual clinical sample is used as the sample to be tested.
[0035] The clinically extracted DNA samples to be tested are human normal and cancer cell DNA, tumor tissue genomic DNA, blood cell DNA, serum DNA, various body fluid DNA or various excrement DNA samples.
[0036] The cancer cells can be lung cancer cells, gastric cancer cells, colon cancer cells, rectal cancer cells, liver cancer cells, breast cancer cells, lymphoma cells, bladder cancer cells, ovarian cancer cells, kidney cancer cells or pancreatic cancer cells; The tissue can be lung cancer tis...
Embodiment approach ( 3
[0038] On the basis of the implementation methods (1) and (2), taking the sequence of the transcription promoter region of the P16 gene as an example, the specific PCR primers are designed as follows:
[0039] Methylation of the transcription promoter region of P16 gene is a characteristic of many cancer cells such as lung cancer. The sequence of the transcription promoter region of the P16 gene is as follows, and the underlined part is the selected region to be detected.
[0040] Homo sapiens p16 protein (CDKN2A) gene, CpG island and partial cds, DQ325544.1
[0041] CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGCGCTGCCCAACGCACCGAATAGGATTACGCCG
[0042] Methylated DNA sequence, the underlined part is the selected detection region, bold U Unmethylated "C" converted to uracil by sodium sulfite treatment
[0043] U GGA UU GCGTGCGCT U GGCGGCTGCGGAGAGGGG...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com