Marine fish mitochondrial genome control area amplification primer, as well as design and amplification methods

A mitochondrial genome and amplification primer technology, applied in DNA preparation, recombinant DNA technology, DNA/RNA fragments, etc., can solve the problems of ineffective amplification of most marine fish and different amplification capabilities, and achieve strong amplification Abilities, effects of wide expansion range

Inactive Publication Date: 2012-04-11
ZHEJIANG OCEAN UNIV
View PDF2 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the selection of the design template sequence, the different design methods, and the limitations of the amplification ability of the universal primers themselves, the use of the reported universal primers cannot effectively amplify most marine fishes, mainly cichlids, so the design of a new The universal primers for the control region of , which are complementary to the reported primers, are necessary to effectively obtain the sequences of the control region of most fish mitochondria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marine fish mitochondrial genome control area amplification primer, as well as design and amplification methods

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Design and synthesis of primers for amplification of the mitochondrial genome control region of marine fish:

[0029] Log in to the GenBank database on the NCBI website to search for the tRNA-Thr and tRNA-Phe gene sequences of the mitochondrial genomes of marine fishes that have been determined, load the sequences into the analysis software MEGA4.1, and use the ClustalW algorithm to perform multiple sequence alignment Analyze, find the conserved sequence, load the found conserved sequence into the Premier Primer5.0 software and design the marine fish mitochondrial genome control region expansion in the manual design mode (that is, select Low under the manual option, and the specific parameters are the default settings). Booster primers: the light chain primer Marinefish-Dloop-Thr-F (SEQ ID No.1) has 20 bases: AGCACCGGTCTTGTAAACCG, located on the tRNA-Thr gene, and the heavy chain primer Marine-Dloop-Phe-R (SEQ ID No. .2) There are 21 bases: GGGCTCATCTTAACATCTTCA, loc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of research of marine fish mitochondrial genome control areas, and relates to an amplification primer of the marine fish mitochondrial genome control area. The amplification primer is composed of two chains of single-chain oligonucleotide, wherein a light-chain primer is a nucleotide sequence shown in SEQ ID No.1 and a heavy-chain primer is a nucleotide sequenceshown in SEQ ID No.2. The invention also provides a design method of the amplification primer and a method for amplifying the marine fish mitochondrial genome control area utilizing the amplificationprimer. The amplification primer provided by the invention can efficiently and specifically amplify the marine fish mitochondrial genome control area, and can be applicable to large-scale investigation and analysis of fish seed resources, thereby providing a powerful tool for rapidly and efficiently obtaining the marine fish mitochondrial genome control area sequence to carry out variety identification, seed resource investigation and control area evolution research.

Description

technical field [0001] The invention belongs to the research field of the mitochondrial genome control region of marine fish, and relates to a pair of PCR amplification primers (Marinefish-Dloop), in particular to an amplification primer capable of efficiently and specifically amplifying the mitochondrial genome control region of most marine fishes and Design method and amplification method. Background technique [0002] Animal mitochondrial genomic DNA is covalently closed circular, including a light chain and a heavy chain, and is a genetic factor with autonomous replication, transcription and translation capabilities outside the nucleus. Compared with nuclear DNA, animal mitochondrial genomic DNA has the characteristics of high copy number, fast primary structure evolution, and strict maternal inheritance, so it has become a powerful tool for aquaculture, fishery genetics research and evolutionary biology research. Mitochondrial genome consists of 37 coding genes and a m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/10
Inventor徐田军王日昕程远志石戈孙悦娜
OwnerZHEJIANG OCEAN UNIV