Primer and polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting mycobacteria
A mycobacteria and kit technology, applied in the biological field, can solve the problems of standardization influence, lack of standardization of detection methods and kits, and achieve the effects of high accuracy, high degree of automation, and low false positive rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Preparation of primers for mycobacterium PCR-DHPLC kit
[0058] According to the 300bp sequence of Mycobacterium-specific 16s rRNA, select one of the sequences (GeneBank No. CP000611), use DNAman 5.0 software, and design the sequence as SEQ ID No. 1, according to the primer annealing temperature at about 60°C. The primer pair shown in SEQ ID No. 2:
[0059] Upstream primer (primer I) SEQ ID No. 1: TAACT GTGAG CGTGC G;
[0060] Downstream primer (Primer II) SEQ ID No. 2: GGCAC GGATC CCAA.
[0061] Blast homology analysis showed that the selected primers had specific sequences of Mycobacterium and had no homology with other sequences. The length of the primer amplified product is 240bp, and its nucleotide sequence is shown in SEQ ID No. 3:
[0062] TAACTGTGAGCGTGCGGGCGATACGGGCAGACTAGAGTACTGCAGGGGAGACTGGAATTCCTGGTGTAGCGGTGGAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAGGCGGGTCTCTGGGCAGTAACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGGTGGGTACTAGGTGTGGGTTTCCTT...
Embodiment 2
[0064] Example 2: Establishment and optimization of PCR detection reaction system for mycobacterium PCR-DHPLC kit
[0065] 1. Method
[0066] 1. Optimization of primer concentration
[0067] In the experiment, the primer concentration started from 0.1μmol / L and increased by 0.1μmol / L to 0.6μmol / L. The matrix method was used for the comparison experiment, and the other conditions of the comparison experiment were completely consistent.
[0068] 2. Optimization of Taq DNA polymerase (Taq enzyme)
[0069] The definition of one unit of Taq enzyme: the amount of enzyme required to mix 10μmol / L of dNTP into acid-soluble substances at 74°C for 30 minutes.
[0070] In the case of fixing other reaction components unchanged, use different enzyme amounts (5U, 4U, 3U, 2U and 1U) for optimization. According to the experimental results and cost, finally select 2U as the enzyme amount for PCR reaction.
[0071] 3.Mg 2+ Optimization of concentration
[0072] Mg 2+ It will affect the specificity and amplif...
Embodiment 3
[0087] Example 3: PCR-DHPLC detection kit for mycobacteria
[0088] The kit includes the following components, and the storage temperature is -20°C;
[0089] PCR buffer;
[0090] Primer I, whose nucleotide sequence is shown in SEQ ID No. 1;
[0091] Primer II, its nucleotide sequence is shown in SEQ ID No. 2;
[0092] dNTP;
[0093] MgCl 2 ;
[0094] Taq DNA polymerase 5U / μL;
[0095] Double distilled water
[0096] Negative control: sterilized normal saline;
[0097] Positive control: plasmid DNA carrying the amplified product.
[0098] When the kit of the present invention is used, the final concentration of the PCR reaction solution is prepared as: 10×PCR buffer; 0.2μmol / L primer I; 0.2μmol / L primer II, 0.2μmol / L probe; 0.2mmol / L dNTP, MgCl 2 2.5mmol / L.
[0099] Preparation method of positive control:
[0100] Using primer I and primer II, the DNA of Mycobacterium tuberculosis was used as a template for PCR amplification, the PCR product was recovered and purified, and connected to the pEASY...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


