Primer and polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting mycobacteria

A mycobacteria and kit technology, applied in the biological field, can solve the problems of standardization influence, lack of standardization of detection methods and kits, and achieve the effects of high accuracy, high degree of automation, and low false positive rate.

Inactive Publication Date: 2012-05-02
INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of molecular biology technology, many laboratories at home and abroad have carried out research on PCR methods for tuberculosis and paratuberculosis, but the lack of standardization of detection methods and kits is the key to affecting the accuracy of PCR results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting mycobacteria
  • Primer and polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting mycobacteria
  • Primer and polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting mycobacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Preparation of primers for mycobacterium PCR-DHPLC kit

[0058] According to the 300bp sequence of Mycobacterium-specific 16s rRNA, select one of the sequences (GeneBank No. CP000611), use DNAman 5.0 software, and design the sequence as SEQ ID No. 1, according to the primer annealing temperature at about 60°C. The primer pair shown in SEQ ID No. 2:

[0059] Upstream primer (primer I) SEQ ID No. 1: TAACT GTGAG CGTGC G;

[0060] Downstream primer (Primer II) SEQ ID No. 2: GGCAC GGATC CCAA.

[0061] Blast homology analysis showed that the selected primers had specific sequences of Mycobacterium and had no homology with other sequences. The length of the primer amplified product is 240bp, and its nucleotide sequence is shown in SEQ ID No. 3:

[0062] TAACTGTGAGCGTGCGGGCGATACGGGCAGACTAGAGTACTGCAGGGGAGACTGGAATTCCTGGTGTAGCGGTGGAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAGGCGGGTCTCTGGGCAGTAACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGGTGGGTACTAGGTGTGGGTTTCCTT...

Embodiment 2

[0064] Example 2: Establishment and optimization of PCR detection reaction system for mycobacterium PCR-DHPLC kit

[0065] 1. Method

[0066] 1. Optimization of primer concentration

[0067] In the experiment, the primer concentration started from 0.1μmol / L and increased by 0.1μmol / L to 0.6μmol / L. The matrix method was used for the comparison experiment, and the other conditions of the comparison experiment were completely consistent.

[0068] 2. Optimization of Taq DNA polymerase (Taq enzyme)

[0069] The definition of one unit of Taq enzyme: the amount of enzyme required to mix 10μmol / L of dNTP into acid-soluble substances at 74°C for 30 minutes.

[0070] In the case of fixing other reaction components unchanged, use different enzyme amounts (5U, 4U, 3U, 2U and 1U) for optimization. According to the experimental results and cost, finally select 2U as the enzyme amount for PCR reaction.

[0071] 3.Mg 2+ Optimization of concentration

[0072] Mg 2+ It will affect the specificity and amplif...

Embodiment 3

[0087] Example 3: PCR-DHPLC detection kit for mycobacteria

[0088] The kit includes the following components, and the storage temperature is -20°C;

[0089] PCR buffer;

[0090] Primer I, whose nucleotide sequence is shown in SEQ ID No. 1;

[0091] Primer II, its nucleotide sequence is shown in SEQ ID No. 2;

[0092] dNTP;

[0093] MgCl 2 ;

[0094] Taq DNA polymerase 5U / μL;

[0095] Double distilled water

[0096] Negative control: sterilized normal saline;

[0097] Positive control: plasmid DNA carrying the amplified product.

[0098] When the kit of the present invention is used, the final concentration of the PCR reaction solution is prepared as: 10×PCR buffer; 0.2μmol / L primer I; 0.2μmol / L primer II, 0.2μmol / L probe; 0.2mmol / L dNTP, MgCl 2 2.5mmol / L.

[0099] Preparation method of positive control:

[0100] Using primer I and primer II, the DNA of Mycobacterium tuberculosis was used as a template for PCR amplification, the PCR product was recovered and purified, and connected to the pEASY...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention relates to a primer for detecting mycobacteria. Nucleotide sequences of an upstream primer and a downstream primer are shown as sequence tables, namely SEQ ID No.1 and SEQ ID No.2 respectively. A polymerase chain reaction-denatured high performance liquid chromatography (PCR-DHPLC) kit for detecting the mycobacteria comprises a PCR buffer solution, a primer pair for detecting the mycobacteria, deoxy-ribonucleoside triphosphate (dNTP), MgCl2, thermus aquaticus deoxyribonucleic acid (Taq DNA) polymerase, double distilled water, negative control (sterile physiological saline) and positive control (plasma DNA with an amplification product), wherein a nucleotide sequence of the amplification product is shown as SEQ ID No.3. The invention provides a kit for rapidly detecting the infection of the mycobacteria and a PCR-DHPLC detection method applying the kit. The kit and the detection method have high specificity, sensitivity and throughput, are easy to operate, and have a great practical significance for clinically distinguishing the infection of the mycobacteria and other pathogens.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a universal PCR-DHPLC rapid detection method and kit for mycobacteria. Background technique [0002] Mycobacterium (Mycobacterium), except for Mycobacterium tuberculosis complex (including Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium voles) and Mycobacterium leprae, collectively referred to as non-tuberculous mycobacteria Bacillus. As far as we know, there are more than 200 pathogenic and non-pathogenic mycobacteria in nature. [0003] Tuberculosis is a major infectious disease threatening human and animal health. The World Health Organization (WHO) has specifically issued a global tuberculosis control strategy, and set March 24 every year as World Tuberculosis Day. Mycobacterium tuberculosis complex (Mycobacterium tuberculosis complex, MTC) is the pathogenic bacteria of tuberculosis in humans and mammals, including Mycobacterium tube...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/32
Inventor 陈茹高小博毕英佐刘志玲罗琼林志雄
Owner INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap