Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster

A technology of refraction Malteia and detection kit, which is applied in the direction of microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of lack of specificity, time-consuming and laborious, difficult to adapt to grass-roots on-site detection, etc., and achieve simple operation , the effect of high sensitivity

Active Publication Date: 2012-07-11
GUANGXI VETERINARY RES INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional detection methods of refraction Malteia include electron microscope observation, histocytological examination, in situ hybridization, etc. These methods are time-consuming, labor-intensive, lack of specificity, and have certain limitations in practical work
At present, although the detection methods of refraction Malteia PCR and fluorescent quantitative PCR have been established, their detection sensitivity is relatively high, but conventional PCR requires the use of a PCR machine and gel electrophoresis, and fluorescent quantitative PCR requires the use of more expensive Fluorescence quantitative PCR instrument and reagents, etc., so it is difficult to meet the needs of grassroots on-site detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster
  • LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster
  • LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] 1. Preparation of Oyster Refractive Malteia LAMP Detection Kit

[0024] Reaction solution A: 24 μL per tube, its composition is: 2.5ul 10× isothermal reaction buffer solution, 1.0ul Bst DNA polymerase 8U / ul, 3.5ul 10mM dNTPs, 5ul 25mM magnesium sulfate, 0.25ul 20uM internal primer 1, 0.25 ul 20uM inner primer 2, 2ul 20uM outer primer 1, 2ul 20uM outer primer 2, 1ul 20uM loop primer 1, 1ul 20uM loop primer 2, 1ul 5M betaine, 1ul 625μM calcein and 1ul 12.5mM chloride Manganese and 2.5ul double distilled water.

[0025] Among them, the 10× isothermal reaction buffer solution contains 200mM trishydrochloride with a pH value of 8.8, 100mM potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% Triton X-100.

[0026] The sequence of the inner primer 1 is CGGCTTCTGCAAACACGTTCGAGTCGTCCCGAATCTACCCA (see sequence listing SEQ.ID.No.2),

[0027] The sequence of the inner primer 2 is AGAGGTTGGAAGATTCGCACCGCCGACAAATCCAATGCTCCT (see sequence listing SEQ.ID.No.3), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster. Two specific internal primers, two specific external primers and two specific annular primers are designed by using the loop-mediated isothermal amplification (LAMP) technology and according to a common gene conservative region of the marteilia refringens. By applying the LAMP detection kit, the marteilia refringens of the oyster can be detected by only performing DNA (Deoxyribonucleic Acid) extraction and LAMP on a tissue sample, so that the defects of long detection time, high workload, cross contamination, complex operation and the like existing in the prior art are overcome; and the LAMP detection kit has the advantages of high specificity, high sensitivity, quickness, low cost, simpler operation method and is particularly suitable for the requirement of basic level field rapid detection of the marteilia refringens of the oyster.

Description

technical field [0001] The invention relates to the field of oyster refraction Malteia detection, in particular to an oyster refraction Malteia LAMP detection kit. Background technique [0002] Marteilia refringens is very harmful to oyster culture. It can cause shellfish to lose weight, change color of digestive tract, stop growing and die. Its infection phenomenon is common in countries such as Oceania and Europe. [0003] Traditional detection methods for refraction Malteia include electron microscope observation, histocytological examination, in situ hybridization, etc. These methods are time-consuming, laborious, lack of specificity, and have certain limitations in practical work. At present, although the detection methods of refraction Malteia PCR and fluorescent quantitative PCR have been established, their detection sensitivity is relatively high, but conventional PCR requires the use of a PCR machine and gel electrophoresis, and fluorescent quantitative PCR requires...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 谢芝勋谢丽基庞耀珊刘加波邓显文谢志勤
Owner GUANGXI VETERINARY RES INST