LAMP (Loop-Mediated Isothermal Amplification) detection kit for marteilia refringens of oyster
A technology of refraction Malteia and detection kit, which is applied in the direction of microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of lack of specificity, time-consuming and laborious, difficult to adapt to grass-roots on-site detection, etc., and achieve simple operation , the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] 1. Preparation of Oyster Refractive Malteia LAMP Detection Kit
[0024] Reaction solution A: 24 μL per tube, its composition is: 2.5ul 10× isothermal reaction buffer solution, 1.0ul Bst DNA polymerase 8U / ul, 3.5ul 10mM dNTPs, 5ul 25mM magnesium sulfate, 0.25ul 20uM internal primer 1, 0.25 ul 20uM inner primer 2, 2ul 20uM outer primer 1, 2ul 20uM outer primer 2, 1ul 20uM loop primer 1, 1ul 20uM loop primer 2, 1ul 5M betaine, 1ul 625μM calcein and 1ul 12.5mM chloride Manganese and 2.5ul double distilled water.
[0025] Among them, the 10× isothermal reaction buffer solution contains 200mM trishydrochloride with a pH value of 8.8, 100mM potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% Triton X-100.
[0026] The sequence of the inner primer 1 is CGGCTTCTGCAAACACGTTCGAGTCGTCCCGAATCTACCCA (see sequence listing SEQ.ID.No.2),
[0027] The sequence of the inner primer 2 is AGAGGTTGGAAGATTCGCACCGCCGACAAATCCAATGCTCCT (see sequence listing SEQ.ID.No.3), ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 