Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Modified factor ix polypeptides and uses thereof

A factor, D85I technology, applied in coagulation/fibrinolytic factors, medical preparations containing active ingredients, peptidase, etc., can solve problems such as coagulation defects

Inactive Publication Date: 2012-07-11
BAYER HEALTHCARE LLC
View PDF69 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Insufficient levels of FIX lead to coagulation defects and symptoms resulting from uncontrolled bleeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified factor ix polypeptides and uses thereof
  • Modified factor ix polypeptides and uses thereof
  • Modified factor ix polypeptides and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0137] Example 1: Cloning of Human Factor IX cDNA

[0138] A pair of PCR primers complementary to the libraries at the 5' and 3' ends of the human FIX cDNA coding region were designed according to the published cDNA sequence (NM_000133). 5' primer (FIXF1; ATCATAAGCTT GCCACC ATGCAGCGCGTGAACATG (SEQ ID NO: 3), FIX start codon in bold) contains the first 18 nucleotides of the FIX coding region, including the ATG start codon and HindIII following the consensus Kozak sequence (underlined) restriction site. The 3' primer (FIXR3, ATCATAAGCTTGATTAGTTAGTGAGAGGCCCTG) (SEQ ID NO: 4) contained 22 nucleotides of the FIX sequence located 3'45 nucleotides from the end of the FIX coding region, preceded by a HindIII site. Amplification of cDNA first strand from normal human liver (Stratagene, San Diego, CA) using these primers and a high-fidelity proofreading polymerase (Invitrogen, Carlsbad, CA) resulted in a single band of the expected size (1464 bp) for human FIX cDNA. After digestion ...

Embodiment 2

[0139] Example 2: Generation of Modified Factor IX Polypeptides

[0140] To change individual amino acids within the human FIX sequence, use the Quickchange TM A primer design program (Stratagene, San Diego, CA) designed a pair of primers. Adopt Quickchange TM The II XL Site-Directed Mutagenesis Kit (Stratagene, San Diego, CA) used these primers to generate mutations in the pEAKflcmv-FIX plasmid according to the manufacturer's instructions. Clones containing the desired mutation were identified by DNA sequencing of the entire FIX coding region. The sequences of the sense strand oligonucleotides used to create the mutations are shown in Table 1.

[0141] Table 1

[0142]

[0143]

[0144]

[0145]

[0146]

Embodiment 3

[0147] Example 3: Expression of Factor IX Polypeptide in HKB11 Cells

[0148] To determine whether FIX genes with altered protein sequences could be expressed and secreted from mammalian cells and to determine the effect of these substitutions on FIX clotting activity, expression plasmids encoding these FIX variants were transfected into HKB11 cells. HKB11 is a human cell line generated by fusion of HEK293 cells and B-cell lymphoma.

[0149] HKB11 cells were grown in suspension culture on an orbital shaker (100-125rpm) in CO 2 (5%) cultured in a serum-free medium (Sigma-Aldrich, St.Louis, MO) supplemented with 10ng / mL soluble vitamin K3 at 37°C in an incubator and maintained between 0.25 and 1.5x10 6 The density between cells / mL.

[0150] Cells for transfection were harvested by centrifugation at 1000 rpm for 5 minutes and then placed in a FreeStyle TM 293 expression medium (Invitrogen, Carlsbad, CA) with 1.1x 10 6 cells / mL resuspended. Cells were seeded in 6-well plates ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Extinction coefficientaaaaaaaaaa
Login to View More

Abstract

The invention relates to modified Factor IX polypeptides such as Factor IX polypeptides with one or more amino acid substitutions. The invention also relates to methods of making modified Factor IX polypeptides, and methods of using modified Factor IX polypeptides, for example, to treat patients afflicted with hemophilia B.

Description

[0001] Introduction to related applications [0002] This application claims priority to US Provisional Application Serial No. 61 / 230,551, filed July 31, 2009, and is hereby incorporated by reference for all purposes. field of invention [0003] The present application relates to modified Factor IX polypeptides, eg, Factor IX polypeptides and polymer-conjugated Factor IX polypeptides that exhibit increased specific activity. The present application also relates to methods for producing modified Factor IX polypeptides and conjugates thereof, and methods of using modified Factor IX polypeptides, for example, to treat patients afflicted with hemophilia B. Background of the invention [0004] Hemophilia B affects 1 in 34,500 males and is caused by various genetic defects in the gene encoding coagulation factor IX (FIX) that result in low or undetectable FIX protein in the blood (Kurachi, et al., Hematol. Oncol. Clin. North Am. 6:991-997, 1992; Lillicrap, Haemophilia 4:350-357, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/36
CPCC12Y304/21022C12N9/644A61K38/00A61P7/04C07K14/745C12N15/11A61K38/36
Inventor A.布鲁克斯C.帕特尔蒋晓乔U.格里赞H.阿佩勒王俊
Owner BAYER HEALTHCARE LLC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com