Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique

A surface plasmon and surface plasmon technology, which is applied in measuring devices, scattering characteristic measurement, and material analysis through optical means, can solve problems such as the difficulty of detecting multiple low molecular weight substances at the same time, achieve ultra-sensitive detection, and improve the use of The effect of shortening the life and shortening the sample detection time

Inactive Publication Date: 2012-08-22
王利兵
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problems existing in the prior art, the present invention provides a method for detecting residues of various low-molecular-weight harmful substances in food using surface plasmon resonance spectroscopy technology, which solves the problem that it is difficult to detect multiple low-molecular-weight harmful substances at the same time in the existing surface plasmon resonance technology. The problem with molecular weight substances

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique
  • Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0028] Example: Thrombin is selected as the molecular probe, and the thrombin aptamer sequence is: GGTTGGTGTGGTTGG.

[0029] Five small molecular harmful substances in typical foods were selected as detection objects, namely acetamiprid, kanamycin, oxytetracycline, ochratomycin, and malachite green, and the corresponding aptamer sequences were:

[0030] Acetamiprid aptamer - CCTGCCACGCTCCGCAAGCTTTGTAATTTGTCTGCAGCGGTTCTT

[0031] GATCGCTGACACCATATTATGAAGATAAGCTTGGCACCCGCATCGT

[0032] Kanamycin aptamer - CACCTAATACGACTCSCTATAGCGGATCCGAAGATGGGGGTTG

[0033] AGGCTAAGCCGACCGTAAGTTGGGCCGTCTGGCTCGAACAAGCTTGC

[0034] Oxytetracycline aptamer - CGTACGGAATTCGCTAGCCGAGTTGAGCCGGGCGCGGTACGGGT

[0035] ACTGGTATGTGTGGGGATCCGAGCTCCACGTGGGATCCGAGCTCCACGTG

[0036] Ochratoxin aptamer - GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA

[0037] Malachite green aptamer - GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC.

[0038] The specific operation steps are as follows:

[0039] (1) Aptamer immobilization on...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting multiple harmful substance residual components in food based on a surface plasma resonance (SPR) technique. The method comprises four steps of sensing surface aptamer fixing, sample marking, sample detecting and sensing element regenerating. The surface of a multi-probe optical fiber sensor is connected with the aptamer corresponding to different residual components; a molecular probe marker corresponding to different residual components is added and introduced on the sensing surface; unmarked and marked residual components carry out specificity competitive identification on the corresponding aptamer; molecular probe aptamer solution is introduced and combined with the marked sample connected on the surface of the optical fiber sensor for SPR detection by using the multi-probe optical fiber sensor; and the multi-probe optical fiber sensor can be used for regenerating to realize repeated use of the sensing element. Based on the SPR technique and the aptamer specificity competitive identification, multiple harmful substance residual components in one sample can be simultaneously detected, and the method provided by the invention is particularly suitable for detecting substances with small molecular weight.

Description

technical field [0001] The invention relates to a simultaneous detection technology for multiple residues of harmful substances in food. In particular, based on surface plasmon resonance technology, through the specific competitive recognition of nucleic acid aptamers and unlabeled and labeled samples, a multi-probe optical fiber sensor is used to simultaneously detect multiple harmful substances in food. Background technique [0002] Residues of harmful substances in food have seriously endangered public health. Facing the major challenge of food safety, analysis and detection of harmful substances in food is an important part of ensuring food safety. Among them, Surface Plasmon Resonance (SPR), as an ultra-sensitive and rapid detection method, is one of the ideal tools for food safety detection. However, SPR still has the disadvantages of large signal-to-noise ratio, small response value, and low sensitivity when detecting low molecular weight substances, while acetamipri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N21/55G01N21/552
Inventor王利兵苏荣欣韩伟
Owner王利兵