Method for controlling soot lice by silencing two resistance genes

A resistance gene and gene technology, applied in botany equipment and methods, using vectors to introduce foreign genetic material, angiosperms/flowering plants, etc., can solve problems such as reduced sensitivity to pesticides

Inactive Publication Date: 2014-04-30
INST OF COTTON RES CHINESE ACAD OF AGRI SCI +1
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The molecular resistance mechanism of Bemisia tabaci to organophosphate insecticides may involve the enhancement of carboxylesterase-mediated hydrolytic metabolism and the decrease of sensitivity to insecticides due to point mutations of acetylcholinesterase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for controlling soot lice by silencing two resistance genes
  • Method for controlling soot lice by silencing two resistance genes
  • Method for controlling soot lice by silencing two resistance genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Construction of RNAi vectors with CYP6CM1 gene and coe1 gene as target genes

[0035] (1) Select the CYP6CM1 gene (Iris Karunker, Juergen Benting, Bettina Lueke, et al. Over-expression of cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Biochemistry and Molecular Biology, 2008, 38:634-644) and coe1 gene (Alon M, Alon F, Nauen R, et al. Organophosphates′ resistance in the B-biotype of Bemisia tabaci (Hemiptera: Aleyrodidae) is associated with a point mutation in an ace1-type acetylcholinesterase and overexpression of carboxylesterase.Insect Biochemistry and Molecular Biology, 2008, 38: 940-949) is the RNAi target gene, and Overlap PCR primers F1 / R1 and F2 / R2 were designed according to its sequence:

[0036] F1 ATGGCGGCAGCTATTGACA

[0037] R1 GTTTGGCTTGAACCTGGATGGGATGCCAGAAAATCA

[0038] F2 TTCTGGCATCCCATCCAGGTTCAAGCCAAACTCCA

[0039] R2GCCATACTTTTTCAGCAGGCT

[0040...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, and in particular relates to a method for controlling soot lice by silencing two resistance genes.. The method comprises the following steps of: selecting bemisia tabaci drug-resistant CYP6CM1 gene and coe1 gene as RNAi target gene; embedding partial sequences of the CYP6CM1 gene and the coe1 gene by overlap polymerase chain reaction (PCR), and using the embedded sequence to build an RNAi carrier with inverted repeat sequence; and transforming the RNAi carrier into a target plant, and obtaining transgenic plant capable of controlling the bemisia tabaci. The method is an important supplement of a method for controlling the bemisia tabaci mainly by an insecticide. The method can be used for interfering with the expression of related drug-resistant genes in the bemisia tabaci by the RNAi technology, thus providing technical support for controlling the bemisia tabaci.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for silencing two resistance genes to prevent and control the gray-tailed whitefly. Background technique [0002] Bemisia tabaci (Gennadius) belongs to Homoptera, whitefly family, small whitefly genus, also known as cotton whitefly or sweet potato whitefly, in Asia, Europe, Africa, South America, Central and North America, Oceania and other continents Both are distributed. The host range of Bemisia tabaci is very wide, and it mainly harms plants such as Brassicaceae, Solanaceae, Cucurbitaceae, Fabaceae, Compositae, and Malvaceae. The harm of whitefly mainly comes from its adults and nymphs. Adults and nymphs of Bemisia tabaci pass their stylets through the intercellular space of the host plant and penetrate deep into the phloem to feed, and directly suck the plant juice, which hinders the growth of the host crop and weakens the plant; when the adult lays eggs, the egg stal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00
Inventor刘方张保龙王坤波陈天子蔡小彦
OwnerINST OF COTTON RES CHINESE ACAD OF AGRI SCI