Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses

A technology of Marburg virus and Lassa fever virus, which is applied in the field of pathogenic molecular biology detection, achieves the effect of strong operability and improved ability

Inactive Publication Date: 2012-10-10
INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing technology or industry standard does not involve the rapid detection and identification of the above four viruses in molecular biology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses
  • Multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses
  • Multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: the kit composition of a preferred embodiment of the present invention

[0042] The test kit of a preferred embodiment of the present invention includes in addition to routine reagents such as RT-PCR buffer solution, RT-PCR enzyme mixture, and primers and probes of four kinds of viruses, and the primer sequences are as shown in SEQ ID NO: 1-13. Shown, the probe sequence is shown in SEQ ID NO: 14-18.

[0043] The specific sequences of the primers are as follows:

[0044] Ef: CGGACACACAAAAAGAAAGAA

[0045] Er1: ATCAGTGTCAATGAGAGGAAAAT

[0046] Er2: ATTAGTTTGAGTTTGAGGAAAATG

[0047] Mf: CATCTGATGGGATTCACACTGAG

[0048] Mr: TGGGAGGTACACCTGTCCTGAA

[0049] Lf1: CTCATGGGATTGATGTCACAGA

[0050] Lr1: CGAGGGAGTGCTTCTATAACTGC

[0051] Lf2-1: AAGGACCTATGCCACATGCACAC

[0052] Lr2-1: AGGAGTTATTCTCTTCTTTGCCACC

[0053] Lf2-2: CAAGGATTTGTGTCACATGCACAC

[0054] Lr2-2: AGGGGTTATTTTCCTCTTTGCC

[0055] Rf: ATTCCTGAGACACATGGCAT

[0056] Rr: CACTTCCTTGCATCATCTGA

...

Embodiment 2

[0064] Embodiment 2: detect the sample with a preferred embodiment of the kit of the present invention

[0065] Viral nucleic acid was extracted with the QIAamp Viral RNA Kit from Qiagen, USA.

[0066] Using the kit of a preferred embodiment of the present invention, the concentration of each probe in quadruple fluorescent RT-PCR is 0.2 μM, and the concentration of each primer is 0.2 μM, and four kinds of virulent viruses are detected by real-time fluorescent RT-PCR. The reaction system is designed 20 μL; reaction conditions (on the ABI 7500 instrument): 50°C for 20min (reverse transcription); 95°C for 15min (hot start); 94°C for 45s (denaturation), 60°C for 75s (annealing / extension, collecting fluorescence signals), 45°C cycle. see results figure 1 ,Depend on figure 1 It can be seen that all four viruses detected in this reaction system are positive.

Embodiment 3

[0067] Embodiment 3: detect the sample with a preferred embodiment of the kit of the present invention

[0068] In this example, Ebola virus is used to synthesize a positive control sample, and the positive control is a recombinant plasmid, which consists of connecting the DNA sequence between the upstream and downstream primers of Ebola virus to the pUC57 vector, and the insertion site is SmaI. The concentration of each probe in quadruple fluorescent RT-PCR is 0.2 μM, and the concentration of each primer is 0.2 μM. Real-time fluorescent RT-PCR detection is performed, and the reaction system is set to 20 μL; reaction conditions (on ABI 7500 instrument): 50 ° C for 20 min (reverse transcription); 95°C for 15min (hot start); 94°C for 45s (denaturation), 60°C for 75s (annealing / extension, collecting fluorescence signals), 45 cycles. see results figure 2 ,Depend on figure 2 It can be seen that the detection of Ebola virus in this reaction system is positive.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses. The multiplex fluorescent PCR kit comprises conventional reagents of an RT-PCR buffer and an RT-PCR enzyme mixed liquor and also comprises primers and probes for detecting the four viruses, wherein the primers are shown in sequences of SEG ID NO: 1-13 and the probes are shown in sequences of SEQ ID NO: 14-18. The multiplex fluorescent PCR kit, the primers and the probes realize rapid and accurate detection of pathogens of Ebola hemorrhagic fever, Marburg hemorrhagic fever, Lassa fever and Rift Valley fever, prevent the four infectious diseases from spreading into or out of the frontier port, are accurate and effective, have strong operability, and can be used for detection of the infectious diseases. Through the multiplex fluorescent PCR kit, the primers and the probes, suspect cases can be found timely and a capability of preventing the infectious diseases from spreading into our country is improved.

Description

technical field [0001] The invention relates to the technical field of pathogen molecular biology detection, in particular to a multiplex fluorescent PCR detection kit for simultaneous detection of four severe infectious disease viruses, including Ebola virus, Marburg virus, Lassa fever virus and Rift Valley fever virus and its primers. Background technique [0002] Ebola hemorrhagic fever (EHF) is an acute hemorrhagic infectious disease caused by Ebola virus (EBV). Infection is mainly through contact with body fluids, excretions, and secretions of patients or infected animals. The main clinical manifestations are fever, bleeding, and multiple organ damage. The case fatality rate of Ebola hemorrhagic fever is high, which can reach 50%-90%. The Ebola virus originated in Congo, Africa, and is at the fourth level of the most dangerous biosafety level with the smallpox virus. It first appeared in northern Zaire and southern Sudan in Africa in 1976. The World Health Organizati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 相大鹏师永霞郑夔黄吉城幸芦琴李小波洪烨苏锦坤钟玉清郭波旋
Owner INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com