Check patentability & draft patents in minutes with Patsnap Eureka AI!

Creation method and purpose of paddy rice male sterile line

A technology for male sterility and rice, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and applications, etc., can solve the difficulty of screening excellent combinations, the limitation of the relationship between restorer lines and maintainer lines, and the seed advantage of three-line hybrid rice. complex performance issues

Active Publication Date: 2012-10-17
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation method and purpose of paddy rice male sterile line
  • Creation method and purpose of paddy rice male sterile line
  • Creation method and purpose of paddy rice male sterile line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, the method for the creation of rice male sterile lines

[0026] 1.1 Create eat1 rice male sterile lines by genetic engineering or other means

[0027] The sequence of the coding region of the EAT1 gene in this example is shown in SEQ ID NO.3. The eat1 mutant material in this example was obtained from the conventional japonica rice variety Wuyujing 7 (also known as 9522) through RNA interference or sequence variation of the EAT1 gene.

[0028] 1.2 Cloning of rice fertility control protein gene

[0029] Utilize the population of rice gene positioning cloning (map-based cloning or position cloning) that comprises the fertility control protein gene EAT1 and its mutant gene eat1 that the inventor constructed, and is clear to those skilled in the art. Within the genome fragment, for example, within 100Kb. On this basis, a genomic DNA clone containing the fragment was isolated by a conventional method. After sequencing and further hybridization identificati...

Embodiment 2

[0048] The purposes of embodiment 2eat1 mutant in rice seed production

[0049] The eat1 mutant was used as the male parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, a plant with both male sterility and sterility characteristics was screened, and the plant was crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the plants with both male sterility and sterility characteristics are screened again and crossed with the maintainer line. After multiple generations of cross screening, a new male sterile line is obtained, which is suitable as the female parent in the hybrid combination.

Embodiment 3

[0050] Embodiment 3 restores the method for eat1 mutant male sterility trait

[0051] Transferring the genomic nucleotide sequence encoding the EAT1 gene into the mutant eat1 plant can restore the mutant to the wild-type phenotype.

[0052] Primers used from rice Nipponbare BAC clone (OSJNba0093F12):

[0053] EAT 1-COM-F: 5'AAAAGTCGACCCGAACTGCCGTCTTAATGT 3' and

[0054] EAT 1-COM-R: 5'AAAAGGTGACCGCAGTGACCAGATTGAGATAAC3'

[0055] A 5225bp genome sequence fragment of the EAT1 gene was amplified.

[0056] The fragment was inserted into the binary vector pCAMBIA1301 vector used for transformation of rice through Sal I and BstEII; the sequencing verification was correct, and the vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation to obtain EAT1 complementary Agrobacterium tumefaciens EHA105, The mutant eat1 and wild-type 9522 mature embryo calluses were transformed by genetic transformation to observe whether the mutants would return to the wild-type...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological engineering, and relates to a creation method and a purpose of a paddy rice male sterile line. The creation method is that: (a) with a common biological engineering method, a nucleotide sequence of the amino acid coded as SEQ ID NO.3 is knocked out or changed, such that the amino acid sequence is subjected to deletion or mutation, and theactivity level of the polypeptide corresponding to the amino acid sequence is reduced or lost; or (b) with a common biological engineering method, the expression of the nucleotide sequence of the amino acid sequence coded as SEQ ID NO.3 is suppressed or reduced, and the expression level of the polypeptide corresponding to the amino acid sequence is reduced. During a vegetative growth stage, the paddy rice mutant obtained by the invention has no abnormality. However, a homozygote plant is completely sterile. When the paddy rice mutant is applied in hybridization, the work of female parent emasculation can be eliminated, such that production efficiency is substantially improved, and labor cost is reduced. Therefore, the paddy rice male sterile line provided by the invention has important application in agricultural productions.

Description

technical field [0001] The invention relates to a method for creating rice strains in the technical field of bioengineering, in particular to a method for creating male sterile rice strains and its use, and a method for restoring sterility. Background technique [0002] Rice is one of the main food crops in the world, and it is the most important food crop in my country. China is the largest rice producer and consumer in the world, and more than 60% of Chinese people use rice as a staple food. The annual sown area of ​​rice in my country exceeds 30 million hectares, accounting for 20% of the world and 30% of the country's sown area of ​​grain crops; The average crop yield is more than 45% higher; the yield per unit area is 6.35 tons / ha, which is 65% higher than the global average yield of 3.85 tons / ha. One of the important factors is the widespread cultivation of hybrid rice. [0003] Male sterile line: refers to a female rice with degenerated males (mainly degenerated pol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H1/02C12N15/84
Inventor 张大兵牛宁宁罗治靖陈明姣袁政梁婉琪
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More