Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PHF14 C-terminal protein, its polyclonal antibody and application thereof

A polyclonal antibody and protein technology, which is applied in the fields of application, anti-animal/human immunoglobulin, and the introduction of foreign genetic material using vectors, which can solve problems such as sequence differences

Active Publication Date: 2012-11-07
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the technical difficulty in distinguishing PHF14α from PHF14β is that they are identical in most of their structures, with only a few differences in sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PHF14 C-terminal protein, its polyclonal antibody and application thereof
  • PHF14 C-terminal protein, its polyclonal antibody and application thereof
  • PHF14 C-terminal protein, its polyclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Example 1, Preparation of PHF14 C-terminal protein

[0101] 1. Amplification of the nucleotide sequence of the PHF14C-terminal open reading frame

[0102] The open reading frame of the human PHF14 C-terminal protein gene was amplified from a human placenta cDNA library, and the primer sequences used for amplification were 5'CCGGAATTCTGTGATGAATGCAGACTCTG 3' (SEQ ID NO: 3) and 5'CCGCTCGAGTTTCTTTGGATTTTTCTGTT 3' (SEQ ID NO: 4). PCR conditions: 94°C for 5 minutes; 94°C for 1 minute, 63°C for 1 minute, 72°C for 3 minutes, a total of 20 cycles; 72°C for 5 minutes; keep warm at 4°C. After the product was digested with EcoRI and XhoI (37°C for 3 hours), it was ligated into the cloning vector pGex-5x-1 after the same double digestion with T4 DNA ligase (16°C overnight), and the ligated product was transformed into DH5α (Invitrogen company), after enzyme digestion and identification of positive clones, the C-terminus of the successfully constructed pGex-5x-1-PHF14 will be seque...

Embodiment 2

[0117] Example 2, PHF14 C-terminal protein gene-encoded protein-specific polyclonal antibody

[0118] The purified PHF14 C-terminal protein obtained in Example 1 was used as an antigen and immunized by subcutaneous multi-point injection to prepare the polyclonal antibody of the present invention.

[0119] New Zealand big-eared rabbits (Shanghai Institute of Biological Sciences Animal Experiment Center) of 2-2.5 kg routinely immunized with purified PHF14 C-terminal protein (antigen) back subcutaneously, first immunized with an equal amount of Freund's complete adjuvant (Sigma company) to emulsify the antigen (antigen: Freund's complete adjuvant = 1: 1), each mouse was injected with 1ml (containing 500ug of protein), and the antigen was emulsified with Freund's incomplete adjuvant (Sigma company) at intervals of four weeks (antigen: Freund's incomplete adjuvant = 1: 1) Repeat the injection in the same way, boost the immunization once, repeat the injection with the antigen (disso...

Embodiment 3

[0120] Example 3, Application of PHF14 C-terminal protein polyclonal antibody in Western Blot

[0121] Using the polyclonal antibody obtained in Example 2, Western Blot was used to detect the expression of endogenous and exogenous PHF14 proteins to distinguish the two isoforms of PHF14.

[0122] After the cultured 293A cells were fully lysed in RIPA buffer, sonicated, and then centrifuged at 12000 rpm at 4° C. for 10 minutes, the obtained supernatant was the 293A cell lysate. The PHF14 protein in the cell lysate was detected by standard Western Blot procedure. Proteins were transferred to nitrocellulose membranes (Schleicher & Schuell BioScience, Keene, NH). After blocking for one hour, the polyclonal antibody obtained in Example 2 was used for detection at a ratio of 1:1000, and this time was the detection of endogenous PHF14 protein.

[0123] The 293A cells transfected with Myc-PHF14α and Myc-PHF14β were also lysed by the same method, and the obtained supernatant was the o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a PHF14 C-terminal protein, its polyclonal antibody and an application thereof. According to the invention, human derived PHF14 C-terminal protein is separated, and it is found by chance that the antigen fragment has good immunogenicity. An antibody obtained from an antigen fragment immune animal can specifically identify PHF14 alpha protein instead of PHF14 beta fragment. The PHF14 C-terminal protein and its polyclonal antibody provided by the invention have advantages of simple preparation method, high titer, strong specificity and high sensitivity.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to PHF14 C-terminal protein, its polyclonal antibody and application. Background technique [0002] The PHD zinc finger (PHD finger) domain is a common basic pattern consisting of about 50-80 amino acid residues. The conserved amino acid residues of Cys4-His-Cys3 combine two zinc ions to form a specific structure. Widely present in eukaryotic genomes from yeast to human. PHD zinc finger protein is a kind of zinc finger protein that widely exists in eukaryotes and plays an important role in gene transcription regulation and disease occurrence. The function of most PHD zinc finger proteins is also unclear. [0003] PHF14 (PHD finger protein 14, PHD finger protein 14) is a new human PHD zinc finger protein. It is encoded by the PHF14 gene. PHF14 is an evolutionarily conserved gene located on human chromosome 7 in a single copy form, and finally encodes two pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/63C12N1/21C12P21/02C07K16/18G01N33/68G01N33/53
Inventor 陈正军雷蕾
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products