New method for pest control on basis of ribonucleic acid interfere (RNAi) technology
A gene, insect technology, applied in recombinant DNA technology, DNA/RNA fragments, botanical equipment and methods, etc., can solve problems such as cotton bollworm death
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0249] Example 1. Obtaining target gene information
[0250] Taking the analysis of the Asian corn borer as an example, the method steps are as follows:
[0251] 1. Extraction of total RNA from Ostrinia officinalis
[0252] Extract by conventional Trizol method, purify by conventional method, and treat with DNase to obtain a Total RNA sample with a concentration ≥ 300 ng / μl, a total amount ≥ 6 μg, and an OD260 / 280 of 1.8-2.2.
[0253] 2. Isolation of mRNA and synthesis of cDNA
[0254] The mRNA with polyA was isolated using magnetic beads with oligo-dT, and then the first-strand cDNA was synthesized using random 6-mers and Invitrogen's Superscript II reverse transcriptase kit.
[0255] 3. Gene amplification and sequencing
[0256] Target gene-specific primers (OfSPF: CATGGGGACACAGTTGAGCTTC (SEQ ID NO: 14); OfSPR: TGCTGTAAATCTAGCCTCAGTCA (SEQ ID NO: 15)) were used for amplification, and the obtained gene fragments were purified and ligated to (manufactured by Takara) PMD-18 I...
Embodiment 2
[0260] The synthesis of embodiment 2, dsRNA
[0261] Utilize the method described in the present invention, apply in the middle of the research of corn borer, the inventor selects three structural domains (SP-N, SP-M, SP-C, sequence see Table 2) of storage protein 2 gene, amplifies The primers required for the three domains are shown in Table 3.
[0262] Table 2. Sequences of the three structural domains of the storage protein 2 gene
[0263]
[0264]
[0265] Table 3. Primers used in the synthesis of dsRNA
[0266]
[0267] Among them, EYFP is the enhanced yellow fluorescent protein gene, which is used as the control of exogenous gene.
[0268] The primers described in Table 3 were used to amplify the DNA sequences of the three domains SP-N, SP-M, and SP-C of the storage protein 2 gene as templates for synthesizing dsRNA.
[0269] use T7Kit (purchased from AMBION, product number AM1334) was used to synthesize target gene dsRNA to obtain dsRNA that can be used fo...
Embodiment 3
[0289] Embodiment 3, the silencing effect of dsRNA on the gene of Ostrinia oleatus
[0290] The inventors obtained dsSP-C (dissolved in ddH 2 O) Spray directly on the 1st instar larvae of Ostrinia officinalis, and observe the changes of its gene expression. See the gene expression of storage protein 2 gene (ds OfSP) at 0, 1, 3, and 5 days after spraying Figure 5 .
[0291] From Figure 5 From the results, it can be seen that the expression of this gene was significantly suppressed at day 5 after treatment with dsRNA. Similarly, protein electrophoresis identification found that the expression of storage protein 2 was also significantly inhibited.
PUM
Property | Measurement | Unit |
---|---|---|
Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap