Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for efficient preparation of linear DNA based on simple large-scale PCR

A large-scale, simple technology, applied in the direction of DNA preparation, recombinant DNA technology, etc., can solve the problems of inability to realize industrialized production, high production cost, slow production rate, etc., and achieve the effect of large production scale, low production cost and convenient portability

Inactive Publication Date: 2013-05-01
HUBEI UNIV +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, they still mainly use the traditional PCR method to produce linear DNA. For example, a large-scale PCR platform developed by Vandalia can achieve a daily output of 12L, but due to high production costs and slow production rates, it is still impossible to realize industrial production. need

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficient preparation of linear DNA based on simple large-scale PCR
  • Method for efficient preparation of linear DNA based on simple large-scale PCR
  • Method for efficient preparation of linear DNA based on simple large-scale PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. Large-scale amplification of the linear DNA of the surface membrane protein coding gene (sao) of Streptococcus suis

[0039] sao基因序列为:atgcaaccagatggcggtcaagctacttctaaggctgtgaacgtcaaaattccagccgttgttagattatttggcagagaattgttggaaaacgaatttaagttcgaattgagagaagctaacggtgaagaattgccagttttggatactgctcaaaacactaaggaaggtcaggttcgtttcaagaacttgtcttttgataagccaggaaagtactggtacactatttcagaagtgaaggatgaattgggtggtatagaatacgattctaagtacattgttgccaaaattacggtagaggataggaacggtcaattgcaagctatgattgagtttattgacaacgataacgtatttaacaacttttacactccagccccagctgctgcctctttgtctattaagaaggtcttggaaggtagaactttgaacactggtgagtttgaatttgttttaaagaacgagaagggtgatgaaattgaaaaggtctctaaccaagctgatggttctgttaacttttctgccttgactttcacaaaagagggtacctacacttacactgtttctgaagttgacggtggtttgggagatatcatttacgataagtctgatattaaggctactgtcacagtaaaggataacaaccatggacaattggtttctactgttacctacgaaaactcagaccagatttttgaaaacattttgaacccaggtaagttgattgctccaactactgattcagtaatcacggacaacgaagttagtaaggaggctatgtaa

[0040] Using the method of the present invention, the l...

Embodiment 2

[0049] Embodiment 2, large-scale system amplifies the DNA of the gene encoding influenza virus H1N1 HA protein

[0050] HA基因序列为:atgaaggcaaacctactggtcctgttatgtgcacttgcagctgcagatgcagacacaatatgtataggctaccatgcgaacaattcaaccgacactgttgacacagtactagagaagaatgtgacagtgacacactctgttaacctgctcgaagacagccacaacggaaaactatgtagattaaaaggaataaccccactacaattggggaattgtaacatcgccggatggctcttgggaaacccagaatgcgacccactgcttccagtgagatcatggtcctacattgtagaaacaccaaactctgagaatggaatatgttatccaggagatttcatcgactatgaagaactgagggagcaattgagctcagtgtcatcattcgaaagattcgaaatatttcccaaagaaagctcatggcccaaccacaacacaaacaaaggagtaacggcagcatgctcccatgcggggaaaagcagtttttacagaaatttgctatggctgacggagaaggagggctcatacccaaagctgaaaaattcttatgtgaacaagaaagggaaggaagtccttgtactgtggggtattcatcacccgtctaacagtaaggaacaacagaatctctatcagaatgaaaatgcttatgtctctgtagtgacttcaaattataacaggagatttaccccggaaatagcagaaagacccaaagtaagagatcaagctgggaggatgaactattactggaccttgctaaaacccggagacacaataatatttgaggcaaatggaaatctaatagcaccaaggtatgctttcgcactgagtagaggctttgggtccggcatcatcacctcaaacgcatcaat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for the rapid preparation of linear DNA based on large-scale PCR. The large-scale PCR method with the volume 50-1200 times higher routine PCR is established through utilizing an optimized PCR program based on high-characteristic NDA polymerase RKOD obtained in a Chinese patent (having a patent number of ZL201010229160.5) in a low cost manner, and the content of a PCR product obtained in the invention can reach 300mug / mL. In the invention, dNTPs, a primer and a PCR buffer in a PCR system are added according to a routine PCR concentration, the plasmid template concentration is 1mug / mL, the DNA polymerase amount is 10U / mL, and the large-scale PCR method comprises the following steps: 1, placing a reaction system in 98DEG C water bath for 0.5min; 2, carrying out 72DEG C water bath for 1min; and 3, repeating step 1 and step 2 40 times, and recovering the PCR product. The method provided by the invention can realize of the low-cost, high-rate and large-scale production of the linear DNA, and lays a foundation for the further low-cost, efficient and rapid preparation of linear DNA vaccines for coping with new infectious diseases.

Description

technical field [0001] The invention relates to a low-cost and high-speed method for preparing linear DNA by large-scale PCR (polymerase chain reaction, polymerase chain reaction), which belongs to the field of industrial microorganism applications. Background technique [0002] PCR (polymerase chain reaction, polymerase chain reaction) is a technique for amplifying linear DNA in vitro first invented by Kary B. Mullis (Nobel Laureate for procedure to replicate DNA, science, 1985), and it is the most important basic principle of modern molecular biology. One of the research methods. [0003] PCR simulates the natural replication process of DNA. It utilizes the DNA polymerase-catalyzed reaction mediated by artificially synthesized primers. The primers start to synthesize a DNA strand that is complementary to the template DNA. After a cycle of denaturation, annealing, and extension, the number of DNA strands doubles, and the template is subsequently cycled, and the newly synt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
Inventor 余晓岚马立新卞璐廖峰金梅林王飞赵慧陈全娇
Owner HUBEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More