Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for showing foreign protein macromolecule on surface of T4 bacteriophage by using intracellular synchronous expression method

An exogenous protein and phage technology, applied in the fields of biochemistry and molecular biology, can solve the problems of overexpression of exogenous recombinant protein, solution solubility of recombinant protein and separation and purification efficiency, so as to avoid protein separation and purification Process, manpower saving effect

Active Publication Date: 2013-05-01
江苏愚公生命科技有限公司
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This process will face: 1) the expression level of the overexpression of the exogenous recombinant protein; 2) the solution solubility and separation and purification efficiency of the recombinant protein; Combining efficiency issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for showing foreign protein macromolecule on surface of T4 bacteriophage by using intracellular synchronous expression method
  • Method for showing foreign protein macromolecule on surface of T4 bacteriophage by using intracellular synchronous expression method
  • Method for showing foreign protein macromolecule on surface of T4 bacteriophage by using intracellular synchronous expression method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1, a method for displaying foreign protein macromolecules on the surface of T4 bacteriophage using the intracellular synchronous expression method, the steps are as follows:

[0026] (1) Construction of recombinant protein expression plasmids fused with Hoc protein or Soc protein and foreign protein with the natural regulatory region of T4 bacteriophage:

[0027](1) Fuse the gene coding region of the Hoc protein or Soc protein with the gene coding region of the foreign protein to be displayed, and add the natural regulatory region of T4 phage to control the expression of the Hoc protein or Soc protein at the upstream of the sequence; foreign protein selection From any protein; after fusion, a gene sequence encoding Hoc protein or Soc protein fused with foreign protein is formed after fusion; the plasmid containing this sequence will be synchronized in the process of T4 phage infection and assembly in E. coli cells Express foreign recombinant protein;

[0028] (...

experiment example

[0034] Experimental example, the following illustrates the technical solution of the present invention through two examples.

[0035] Two foreign proteins that are naturally folded and functionally intact: GG protein and gal protein are fused with Soc protein and Hoc protein respectively to form recombinant proteins, which are displayed on the capsid of T4 phage by intracellular synchronous expression.

[0036] (1) Construct the expression plasmid of the recombinant protein fused with Soc protein and gal protein:

[0037] (1) The gene sequence of the Soc protein, including its promoter region, is amplified by PCR (the gene sequence of the Soc protein promoter region is: tataaataatcatgtaatttaaataaaggagaattac). Primer 1 is the first 18 bases of the gene sequence in the promoter region of the Soc protein. Primer 2 is the reverse complementary sequence of the following sequence: the last 21 bases of the coding region of the Soc protein gene except the stop codon, plus the first 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for showing a foreign protein macromolecule on the surface of a T4 bacteriophage by using an intracellular synchronous expression method. The method for showing the foreign protein macromolecule on the surface of the T4 bacteriophage comprises the following steps that an expression plasmid of recombinant protein fused by Hoc (Highly-antigenic Outer Capsid) protein or Soc (Small Outer Capsid) protein with a natural T4 bacteriophage control area and foreign protein is constructed; the expression plasmid of the foreign recombinant protein is transformed into an escherichia coli cell; the escherichia coli cell containing the expression plasmid of the foreign recombinant protein is infected by an Hoc protein and Soc protein deleted T4 bacteriophage virus strain; T4 bacteriophage particles generated in the infection step and showing the foreign recombinant protein are separated; and the foreign recombinant protein shown on capsid of the obtained T4 bacteriophage particles is detected. The method does not require overexpression of the foreign recombinant protein, avoids a technical difficulty that large-amount overexpression of the foreign recombinant protein is required in an in-vitro showing method, does not require separation or purification of the foreign recombinant protein, and avoids a time-consuming and expensive protein separation and purification process.

Description

technical field [0001] The invention relates to the fields of biochemistry and molecular biology, in particular to a method for displaying foreign protein macromolecules on the surface of T4 bacteriophage by using an intracellular synchronous expression method. Background technique [0002] There are two modified proteins on the capsid surface of T4 phage, namely Hoc protein and Soc protein. These two proteins are non-essential proteins, that is, deletion or transformation of these two proteins will not affect the replication and amplification of T4 phage. Based on this characteristic of the two protein molecules, and by means of molecular biology, the foreign protein (that is, the protein other than T4 phage itself) can be recombined with Hoc or Soc protein, and displayed on the surface of T4 phage. The technology of displaying exogenous recombinant protein on the surface of T4 bacteriophage by means of molecular biology has shown great potential application value in vacci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N7/01C12R1/92
Inventor 高嵩陶攀许恒皓刘伟尹欣程斌
Owner 江苏愚公生命科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com