Method for showing foreign protein macromolecule on surface of T4 bacteriophage by using intracellular synchronous expression method
An exogenous protein and phage technology, applied in the fields of biochemistry and molecular biology, can solve the problems of overexpression of exogenous recombinant protein, solution solubility of recombinant protein and separation and purification efficiency, so as to avoid protein separation and purification Process, manpower saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1, a method for displaying foreign protein macromolecules on the surface of T4 bacteriophage using the intracellular synchronous expression method, the steps are as follows:
[0026] (1) Construction of recombinant protein expression plasmids fused with Hoc protein or Soc protein and foreign protein with the natural regulatory region of T4 bacteriophage:
[0027](1) Fuse the gene coding region of the Hoc protein or Soc protein with the gene coding region of the foreign protein to be displayed, and add the natural regulatory region of T4 phage to control the expression of the Hoc protein or Soc protein at the upstream of the sequence; foreign protein selection From any protein; after fusion, a gene sequence encoding Hoc protein or Soc protein fused with foreign protein is formed after fusion; the plasmid containing this sequence will be synchronized in the process of T4 phage infection and assembly in E. coli cells Express foreign recombinant protein;
[0028] (...
experiment example
[0034] Experimental example, the following illustrates the technical solution of the present invention through two examples.
[0035] Two foreign proteins that are naturally folded and functionally intact: GG protein and gal protein are fused with Soc protein and Hoc protein respectively to form recombinant proteins, which are displayed on the capsid of T4 phage by intracellular synchronous expression.
[0036] (1) Construct the expression plasmid of the recombinant protein fused with Soc protein and gal protein:
[0037] (1) The gene sequence of the Soc protein, including its promoter region, is amplified by PCR (the gene sequence of the Soc protein promoter region is: tataaataatcatgtaatttaaataaaggagaattac). Primer 1 is the first 18 bases of the gene sequence in the promoter region of the Soc protein. Primer 2 is the reverse complementary sequence of the following sequence: the last 21 bases of the coding region of the Soc protein gene except the stop codon, plus the first 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
