Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving biosynthesis of levodopa

A technology for levodopa and biosynthesis, which is applied in the biological medicine field, can solve the problems of high production cost, low yield, complicated operation process, etc., and achieves the effects of increasing yield, reducing production cost, and simplifying operation process

Inactive Publication Date: 2013-05-29
TIANJIN UNIV
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, the method of the prior art has the disadvantages of low yield, high production cost and complex operation process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving biosynthesis of levodopa
  • Method for improving biosynthesis of levodopa
  • Method for improving biosynthesis of levodopa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A method for improving levodopa biosynthesis, comprising the steps of:

[0030] (1) Select the 4-hydroxyphenylacetic acid-3-hydroxylase gene (hpaBC) sequence of E. coli BL21 strain for expression in Escherichia coli, and the length of the hpaBC gene is 2093bp.

[0031] Primers were designed as follows:

[0032] hpaBC-UP:

[0033] CGCGGATCCGATGAAACCAGAAGATTTCCGCG (BamH I restriction site) (SEQ ID No.1)

[0034] hpaBC-DOWN:

[0035] CCCAAGCTTAAATCGCAGCTTCCATTTCC (Hind III restriction site) (SEQ ID No.2)

[0036] Using the E.coli BL21 strain as a template, use FASTpfu enzyme to perform PCR, recover the hpaBC gene fragment (2093bp) shown in the sequence table SEQ ID No.3, and use BamH I and Hind III to double-digest the pCDFDuet-1 plasmid and hpaBC Gene fragments, and then use T4 ligase to carry out ligation reaction to make recombinant plasmid pBET1;

[0037] The PCR reaction conditions were: 97°C, 7min, 1 cycle; 95°C, 30s, 60°C, 30s, 72°C, 2min, a total of 30 cycles;...

Embodiment 2

[0045] A method for improving levodopa biosynthesis, comprising the steps of:

[0046] Steps (1)-(2) are the same as in Example 1;

[0047] (3) Screen the transformed host cells on a plate to obtain a single colony of levodopa-producing engineered bacteria. After activating the obtained levodopa-producing engineered bacteria strains, take 1 ml and put it into 100 ml of the first culture medium. Cultivate at 220r / min for 4 hours, take samples to measure OD 600 0.5, add 1mL of 1mmol / L isopropyl-β-D-thiogalactopyranoside aqueous solution, and add ascorbic acid at the same time, so that the concentration of ascorbic acid is 0.5g / L and continue to cultivate for 24 hours to measure the content of levodopa .

[0048] After determination and calculation, the content of levodopa is 90.8mg / L, see Figure 5 .

Embodiment 3

[0050] A method for improving levodopa biosynthesis, comprising the steps of:

[0051] Steps (1)-(2) are the same as in Example 1;

[0052] (3) Screen the transformed host cells on a plate to obtain a single colony of levodopa-producing engineered bacteria. After activating the obtained levodopa-producing engineered bacteria strains, take 1 ml and put it into 100 ml of the first culture medium. Cultivate at 220r / min for 4 hours, take samples to measure OD 600 0.5, add 1mL of 1mmol / L isopropyl-β-D-thiogalactopyranoside aqueous solution, and add ascorbic acid at the same time, so that the concentration of ascorbic acid is 2.75g / L and continue to cultivate for 24 hours to measure the content of levodopa .

[0053] After determination and calculation, the content of levodopa is 86.7mg / L, see Figure 5 .

[0054] The preparation of the first culture medium in embodiment 2-3 is the same as embodiment 1. The method for measuring the content of levodopa is the same as in Example ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving biosynthesis of levodopa. The method comprises the following steps of: (1) using SEQ ID No.1 and SEQ ID No.2 as the primers, using an E.coli BL21 strain as the template, amplifying and recycling so as to obtain a hpaBC gene segment, conducting double digestion on a pCDFDuet-1 plasmid and the hpaBC gene segment, connecting and preparing a recombinant plasmid pBET1; (2) introducing the recombinant plasmid pBET1 into host escherichia coli so as to obtain transformed host cells; and (3) selecting the transformed host cells so as to obtain a levodopa production engineering bacteria single colony, taking 1ml of the levodopa production engineering bacteria single colony and putting into 100ml of a first culture medium, cultivating and measuring OD600, adding an isopropyl-beta-D-sulfo-pyran galactoside water solution and ascorbic acid, continuing cultivating and measuring the content of the levodopa. By utilizing the method disclosed by the invention, the output of the levodopa is increased, the production cost is lowered, and the operation process is simplified.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a production method of levodopa, in particular to a method for biosynthesis of levodopa. Background technique [0002] Parkinson's disease, also known as "parkinson's paralysis", is a neurological disease that seriously endangers human health. Its symptoms are tremors at rest, central persistent muscle tension, resulting in muscle pain or inability to straighten the body. Akinesia and slowness of movement. Patients often fall due to lack of balance, resulting in involuntary emotional reactions or body movements. According to statistics, the incidence of Parkinson's disease in the general population under the age of 60 is 0.1%, the incidence rate of the elderly over the age of 60 is 1%, and the incidence rate of the elderly over the age of 80 is 2%. Parkinson's disease has become a disabling disease that seriously endangers the health of the elderly after tumors and cardiovasc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/22C12N15/31C12N15/63C12N1/21C12R1/19
Inventor 赵广荣李雪楠李杨俊逸吕佳绯邢畅叶菁睿
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com