Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting trivalent arsenic by protoheme horseradish peroxidase catalytic colorimetry

A technology of trivalent arsenic and hemin, which is used in material analysis by observing the effect on chemical indicators, measurement of color/spectral properties, and analysis by chemical reaction of materials, etc., can solve the problem of inappropriate modification, Sequence length and other problems, to achieve the effect of simple operation, good selectivity and high detection sensitivity

Active Publication Date: 2013-06-19
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although Kim et al. screened the nucleic acid aptamer of inorganic arsenic through SELEX technology, it is not suitable for modification due to its long sequence. The use of hemin peroxide catalyzed colorimetry for detection has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting trivalent arsenic by protoheme horseradish peroxidase catalytic colorimetry
  • Method for detecting trivalent arsenic by protoheme horseradish peroxidase catalytic colorimetry
  • Method for detecting trivalent arsenic by protoheme horseradish peroxidase catalytic colorimetry

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] like figure 1 As shown, this embodiment includes the following steps:

[0028] 1) Prepare a detection system with a known concentration of trivalent arsenic: Take five 2mL graduated centrifuge tubes and add 5 μL of arsenic nucleic acid aptamer stock solution with a concentration of 500 μM respectively (the sequence of the arsenic nucleic acid aptamer is: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3') and 5 μL of different concentrations of trivalent arsenic standard solution, so that the content of trivalent arsenic in the entire detection system is maintained at 10-100 ppb, and after thorough mixing, the centrifuge tube is incubated at 25 ° C for 30 min. 100 μL Hemin was added to the above solution, and incubated at 25° C. for 10 min. Then add deionized water to 350 μL. Finally, add 100 μL of 200 mM HO 2 o 2 The solution and 50 μL of 5 mM TMB solution were thoroughly mixed, and then the centrifuge tube wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting trivalent arsenic in water body through a colourimetry by using protoheme peroxidase catalytic activity, chlorhematin has horseradish peroxidase activity, under the existence of hydrogen peroxide, a chromogenic substrate 3,3', 5,5'-tetramethyl benzidine (TMB) can be catalyzed to generate an oxidation reduction reaction, the solution have variable color change by naked eyes, the addition of a nucleic acid aptamer can inhibit catalytic activity, after adding the trivalent arsenic in the solution, the catalytic activity obtains recovery, so that the color of a whole system enables substantial change, the absorbance and trivalent arsenic concentration at 442nm present a direct proportion relation, thereby the method can be used for detecting the trivalent arsenic of the water body. The detection method provided by the invention has the advantages of high sensitivity and good selectivity, the lowest detection limit is 1ppb, the operation is simple, and a large-scale apparatus is not required, and the method can be used for detecting the trivalent arsenic in drinking water.

Description

technical field [0001] The invention relates to a method in the technical field of water body safety detection, in particular to a method for detecting trivalent arsenic by utilizing the activity of hemin horseradish peroxidase through ultraviolet-visible absorption spectrum. Background technique [0002] Inorganic arsenic compounds are recognized human carcinogens, widely distributed in soil, rocks and water bodies, and arsenic compounds in water bodies can easily enter the human body through the digestive tract. The hardest-hit areas of water arsenic poisoning are mainly distributed in parts of China, India, Bangladesh and Vietnam, and my country is one of the countries with the most complete types of arsenic poisoning and the most serious poisoning hazards in the world, so rapid and accurate detection of arsenic in water It is one of the effective means to put an end to such hazards. Inorganic arsenic in water, especially trivalent arsenic, is the most toxic, 60 times mor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/78G01N21/31G01N21/33
Inventor 周培吴远根王法泽詹深山刘乐徐鲁荣
Owner SHANGHAI JIAO TONG UNIV