Method for detecting trivalent arsenic by protoheme horseradish peroxidase catalytic colorimetry
A technology of trivalent arsenic and hemin, which is used in material analysis by observing the effect on chemical indicators, measurement of color/spectral properties, and analysis by chemical reaction of materials, etc., can solve the problem of inappropriate modification, Sequence length and other problems, to achieve the effect of simple operation, good selectivity and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] like figure 1 As shown, this embodiment includes the following steps:
[0028] 1) Prepare a detection system with a known concentration of trivalent arsenic: Take five 2mL graduated centrifuge tubes and add 5 μL of arsenic nucleic acid aptamer stock solution with a concentration of 500 μM respectively (the sequence of the arsenic nucleic acid aptamer is: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3') and 5 μL of different concentrations of trivalent arsenic standard solution, so that the content of trivalent arsenic in the entire detection system is maintained at 10-100 ppb, and after thorough mixing, the centrifuge tube is incubated at 25 ° C for 30 min. 100 μL Hemin was added to the above solution, and incubated at 25° C. for 10 min. Then add deionized water to 350 μL. Finally, add 100 μL of 200 mM HO 2 o 2 The solution and 50 μL of 5 mM TMB solution were thoroughly mixed, and then the centrifuge tube wa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com