HIV-1 virus protease inhibitor drug resistance mutation detection kit and method
A protease inhibitor, HIV-1 technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of high technical requirements, lack of quality assurance of detection methods, and insensitivity of parvovirus samples And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0130] Embodiment 1: Using the present invention to detect HIV-1 viral protease inhibitor single-site drug-resistant mutations
[0131] In this embodiment, all HIV-1 viral protease inhibitor drug-resistant mutation types involved in the present invention, as well as wild-type HIV-1 viral protease gene types that do not contain any mutations, are detected.
[0132] 1. Preparation of Oligonucleotide Primers and Probes
[0133] Table 1 and Table 2 show the sequences of primers and probes used in the detection of HIV-1 viral protease inhibitor resistance mutations in the present invention, all of which were synthesized by Shanghai Yingjun Biotechnology Co., Ltd.
[0134] Table 1 HIV-1 viral protease gene segment amplification primers
[0135] Primer number
Primer sequence (5'-3')
[0136] PMV-001
gagagcttcaggtctgggg
PMV-002
CTGTTAGTGCTTTGGTTCCTCT
PMV-003
gaagcaggagccgatagaca
PMV-017
TAMRA-TCACTTGCTTCCGTTGAGGTGGYTT...
Embodiment 2
[0198] Example 2: Using the present invention to detect HIV-1 viral protease inhibitor multi-site and low-abundance drug-resistant mutations
[0199] This example illustrates that the method and kit provided by the present invention can simultaneously detect samples containing multiple HIV-1 viral protease inhibitor resistance mutations.
[0200] This example also shows that the method provided by the present invention can detect drug-resistant mutations with an abundance as low as 2% contained in the sample, and is a method with extremely high sensitivity.
[0201] 1. Preparation of Oligonucleotide Primers and Probes
[0202] Method and steps are the same as in Example 1.
[0203] 2. Preparation of HIV-1 Viral Protease Inhibitor Resistance Mutation Detection Chip
[0204] Method and steps are the same as in Example 1.
[0205] 3. Preparation of samples to be tested
[0206]The samples to be tested (SP-1-4) in this example contained at least two types of protease inhibitor...
Embodiment 3
[0228] Embodiment 3, using the present invention to detect drug-resistant mutations of HIV-1 viral protease inhibitors in plasma, whole blood and nucleic acid samples
[0229] This example illustrates that the method and kit provided by the present invention can be used to detect drug-resistant mutations of HIV-1 virus protease inhibitors in plasma, whole blood and nucleic acid samples.
[0230] 1. Preparation of Oligonucleotide Primers and Probes
[0231] Method and steps are the same as in Example 1.
[0232] 2. Preparation of HIV-1 Protease Inhibitor Resistance Mutation Detection Chip
[0233] Method and steps are the same as in Example 1.
[0234] 3. Preparation of samples to be tested
[0235] In this embodiment, clinically collected whole blood (WB-1-3), plasma (XJ-1-2) and nucleic acid (R-1-2, D-1) samples are tested. After high-throughput sequencing, whole blood sample WB-1 contained protease inhibitor resistance mutation M46L, WB-2 contained drug resistance mutati...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


