HIV-1 virus protease inhibitor drug resistance mutation detection kit and method

A protease inhibitor, HIV-1 technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of high technical requirements, lack of quality assurance of detection methods, and insensitivity of parvovirus samples And other issues

Inactive Publication Date: 2013-07-24
ZHEJIANG UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Phenotypic drug resistance is the gold standard for drug resistance detection. It directly provides drug resistance and can be quantified, but the disadvantages are also obvious, namely high technical requirements, time-consuming, and high cost. Therefore, gene is widely used in clinical practice internationally. type drug resistance detection
[0013] Further application limitations of genotypic and phenotypic testing include lack of quality assurance for existing testing methods; high cost of testing; insensitivity to parvovirus specimens; There are detection methods that may not detect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HIV-1 virus protease inhibitor drug resistance mutation detection kit and method
  • HIV-1 virus protease inhibitor drug resistance mutation detection kit and method
  • HIV-1 virus protease inhibitor drug resistance mutation detection kit and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] Embodiment 1: Using the present invention to detect HIV-1 viral protease inhibitor single-site drug-resistant mutations

[0131] In this embodiment, all HIV-1 viral protease inhibitor drug-resistant mutation types involved in the present invention, as well as wild-type HIV-1 viral protease gene types that do not contain any mutations, are detected.

[0132] 1. Preparation of Oligonucleotide Primers and Probes

[0133] Table 1 and Table 2 show the sequences of primers and probes used in the detection of HIV-1 viral protease inhibitor resistance mutations in the present invention, all of which were synthesized by Shanghai Yingjun Biotechnology Co., Ltd.

[0134] Table 1 HIV-1 viral protease gene segment amplification primers

[0135] Primer number

Primer sequence (5'-3')

[0136] PMV-001

gagagcttcaggtctgggg

PMV-002

CTGTTAGTGCTTTGGTTCCTCT

PMV-003

gaagcaggagccgatagaca

PMV-017

TAMRA-TCACTTGCTTCCGTTGAGGTGGYTT...

Embodiment 2

[0198] Example 2: Using the present invention to detect HIV-1 viral protease inhibitor multi-site and low-abundance drug-resistant mutations

[0199] This example illustrates that the method and kit provided by the present invention can simultaneously detect samples containing multiple HIV-1 viral protease inhibitor resistance mutations.

[0200] This example also shows that the method provided by the present invention can detect drug-resistant mutations with an abundance as low as 2% contained in the sample, and is a method with extremely high sensitivity.

[0201] 1. Preparation of Oligonucleotide Primers and Probes

[0202] Method and steps are the same as in Example 1.

[0203] 2. Preparation of HIV-1 Viral Protease Inhibitor Resistance Mutation Detection Chip

[0204] Method and steps are the same as in Example 1.

[0205] 3. Preparation of samples to be tested

[0206]The samples to be tested (SP-1-4) in this example contained at least two types of protease inhibitor...

Embodiment 3

[0228] Embodiment 3, using the present invention to detect drug-resistant mutations of HIV-1 viral protease inhibitors in plasma, whole blood and nucleic acid samples

[0229] This example illustrates that the method and kit provided by the present invention can be used to detect drug-resistant mutations of HIV-1 virus protease inhibitors in plasma, whole blood and nucleic acid samples.

[0230] 1. Preparation of Oligonucleotide Primers and Probes

[0231] Method and steps are the same as in Example 1.

[0232] 2. Preparation of HIV-1 Protease Inhibitor Resistance Mutation Detection Chip

[0233] Method and steps are the same as in Example 1.

[0234] 3. Preparation of samples to be tested

[0235] In this embodiment, clinically collected whole blood (WB-1-3), plasma (XJ-1-2) and nucleic acid (R-1-2, D-1) samples are tested. After high-throughput sequencing, whole blood sample WB-1 contained protease inhibitor resistance mutation M46L, WB-2 contained drug resistance mutati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an HIV-1 protease inhibitor drug resistance mutation detection method and a kit. Specifically, the invention also discloses a probe for detection of human immunodeficiency virus protease gene drug resistance mutation, and the probe includes a probe for detection of protease gene D30N mutation, a probe for detection of protease gene V32I mutation, a probe for detection of protease gene M46I and M46L mutation, a probe for detection of protease gene I47V and I47A mutation, a probe for detection of protease gene G48V mutation, a probe for detection of protease gene I50V mutation, a probe for detection of protease gene I54V mutation, a probe for detection of protease gene V82A, V82F, V82T and V82S mutation, a probe for detection of protease gene I84V mutation, a probe for detection of protease gene N88D mutation, and a probe for detection of protease gene L90M mutation.

Description

technical field [0001] The invention relates to a method for detecting HIV-1 protease inhibitor resistance mutation and a kit thereof. Background technique [0002] 1. Protease inhibitors and their mechanism of action [0003] Acquired Immunodeficiency Syndrome (AcquiredImmuneDeficiencySyndrome, AIDS), also known as AIDS, is one of the world's top ten deadly diseases. HIV-2 type. AIDS patients in most parts of the world are infected by the HIV-1 virus. [0004] Protease (Protease) is very necessary for gag, gag-pol polyprotein, post-translational processing, structural protein forming the core of the virus and other basic enzymes in HIV-1 virus. After the HIV-1 virus enters the blood, the envelope proteins gp120 and CD on the surface of the virus 4 + The CD4 receptor on the surface of T lymphocytes binds, and under the action of gp41 permeable protein, it invades the cell and uncoats it. Protease inhibitors (Protease Inhibitors, PIs) mainly interact with the Asp25, GLy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor张琼李兰娟项春生吴南屏
OwnerZHEJIANG UNIV